ID: 1049585397

View in Genome Browser
Species Human (GRCh38)
Location 8:143430490-143430512
Sequence CCGCGGGCGGCGGTCCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049585380_1049585397 -4 Left 1049585380 8:143430471-143430493 CCTCTCCCCCCCCTGCTCCCCGC 0: 1
1: 1
2: 19
3: 324
4: 3335
Right 1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 297
1049585383_1049585397 -9 Left 1049585383 8:143430476-143430498 CCCCCCCCTGCTCCCCGCGGGCG 0: 1
1: 0
2: 2
3: 47
4: 500
Right 1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 297
1049585384_1049585397 -10 Left 1049585384 8:143430477-143430499 CCCCCCCTGCTCCCCGCGGGCGG 0: 1
1: 0
2: 0
3: 36
4: 307
Right 1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG 0: 1
1: 0
2: 2
3: 27
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049585397 Original CRISPR CCGCGGGCGGCGGTCCCGGC GGG Intergenic
900102302 1:967053-967075 CTGCGGGAGGAGGTCCCGGGAGG - Intronic
900106396 1:983034-983056 CCGCGGGCGACTGCCCGGGCGGG + Intergenic
900113835 1:1020418-1020440 CCTGGGGCGGGGGTCCCGGCGGG - Intronic
900171924 1:1273534-1273556 CCGCGGGCGGCGGGCGCGAACGG + Intronic
900287593 1:1909033-1909055 CCTCGGACGGCGACCCCGGCCGG + Intergenic
901021984 1:6260493-6260515 CCGGGGGCCGCAGTCCCGCCAGG - Intronic
901272227 1:7961490-7961512 CCGCGGGCGCCGGGGCAGGCCGG + Intronic
901641257 1:10694246-10694268 CCGGGGGCCGCGGTCTCGGGCGG - Intronic
903078110 1:20787345-20787367 GCGCGGGAGGCGGGGCCGGCGGG - Intergenic
903413788 1:23168154-23168176 GCGCGGGCCGCGGGCCGGGCGGG - Intronic
903907388 1:26696448-26696470 CCGAGGGCGGCGGCGGCGGCGGG - Exonic
903925139 1:26826635-26826657 CCGCGGCGGGCGGTGGCGGCGGG + Intergenic
904483296 1:30807394-30807416 CGGCGGGCGGCGGCCCGGGGCGG - Intergenic
904688267 1:32275675-32275697 GAGCGGGCGGCGGTCTCGACCGG + Intronic
906044394 1:42817038-42817060 CGGTGGGGGGCGGGCCCGGCTGG - Intronic
908023800 1:59926779-59926801 AAGCAGGCGGCGGTCCCAGCAGG + Exonic
910676545 1:89821545-89821567 CCCCGGGCGGCCGGCCCTGCGGG + Intronic
913222095 1:116667766-116667788 CCGAGTGCGGCGGGCCGGGCTGG - Intergenic
914197338 1:145454430-145454452 CCCGGGGCGGCGGGGCCGGCGGG - Intergenic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
920912617 1:210232852-210232874 CGGCGGGCAAGGGTCCCGGCAGG - Exonic
921472696 1:215567626-215567648 CCGGGCTCGGCGGTCCCGGCTGG + Exonic
922496584 1:226062438-226062460 GTGCGGGCGGCAGTCTCGGCGGG + Intronic
922677864 1:227563788-227563810 CCGCGGCCCGGAGTCCCGGCTGG + Intronic
922730939 1:227948347-227948369 CCGCCGGCGGGGCTCCAGGCCGG + Intergenic
923008005 1:230067381-230067403 GCGCGGGCGGCGGCGCCGGCAGG + Exonic
923193460 1:231642168-231642190 CCGGGGCCGGCGGGGCCGGCCGG + Intronic
923591903 1:235327537-235327559 CCGCGGTCGGGGGCCCGGGCAGG - Intronic
924305931 1:242689525-242689547 CCGGGGCTGGCGGTGCCGGCTGG - Intergenic
1062768607 10:83124-83146 CTGCGGGCTGAGGACCCGGCTGG - Intergenic
1062874068 10:931444-931466 CCGCGGGCGGCCGGTCGGGCGGG - Exonic
1062877667 10:955296-955318 CCACGGGCTGCAGTCCTGGCTGG - Intergenic
1063130293 10:3172459-3172481 CTGCCCGCGGCGCTCCCGGCGGG - Intronic
1065140173 10:22713367-22713389 CAGCAGGCGGGGGTCCCGGCGGG - Intronic
1066022836 10:31319811-31319833 CCGCGCGCCGCGGCCCCGGCCGG + Intronic
1070327748 10:75399491-75399513 CAGCTGGCGGCGGCCGCGGCCGG - Exonic
1072891572 10:99329615-99329637 CGGTGGCCGGCGGTCCTGGCTGG - Exonic
1073305820 10:102502683-102502705 GCGCTAGCGGCGGACCCGGCTGG - Exonic
1074130387 10:110568163-110568185 CCGCCCGCGGCCGCCCCGGCGGG - Intronic
1074753597 10:116609192-116609214 CCCCGGGAGGCGGCCGCGGCAGG - Intergenic
1075866019 10:125719844-125719866 CCTCGAGCGGCGGCCCCGGCCGG - Exonic
1077778218 11:5294661-5294683 CCGCGGCCGGTGGGGCCGGCTGG + Intronic
1077914712 11:6603759-6603781 CGGCGGGCTGCGGGCGCGGCCGG + Intronic
1083448488 11:62726938-62726960 CGTCGGGCGGCGGCCCGGGCGGG - Exonic
1083657081 11:64234807-64234829 CCCCGGCGGGCGGCCCCGGCGGG + Exonic
1084387722 11:68854725-68854747 GCGCGGGCGCCGGGGCCGGCAGG - Intergenic
1085037876 11:73310519-73310541 CCGAGGGCAGCGGTCCCAGGAGG + Exonic
1089273361 11:117316130-117316152 CGGCGGGCGGCGGCGCGGGCAGG + Exonic
1096101013 12:48970493-48970515 CCGAGGGCGGAGGCCGCGGCCGG + Exonic
1096102431 12:48978085-48978107 CCGCGGGCGGCGAGGCGGGCTGG + Intergenic
1096777946 12:53975053-53975075 CCGCGGGCAGCCCTCCCGCCAGG - Intronic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1101606080 12:106248215-106248237 GCGCGGGGCGGGGTCCCGGCGGG + Intronic
1102025528 12:109712374-109712396 CCGCGGGCGCCTCTCCCGGCGGG + Intergenic
1102101418 12:110281482-110281504 CCGCGGCCTGCCCTCCCGGCGGG + Intronic
1103459674 12:121093770-121093792 CCCGGGGCGGCGGTGCCGGCCGG + Intergenic
1103541993 12:121672618-121672640 GCGCGCGCCGCGGGCCCGGCCGG + Intronic
1103547491 12:121712647-121712669 CCGCGTGCGGCGTTCCGGACCGG - Intergenic
1103764651 12:123271621-123271643 CCCCGGGCGGCGGGCGCGCCGGG + Exonic
1104929309 12:132329665-132329687 GCGCGCGGGGCGGTCCCGGGGGG - Intergenic
1104961519 12:132490420-132490442 CGGCGGGCGGCGGGCCGGGCCGG - Exonic
1105779611 13:23695359-23695381 CCGCCGGCTGGGGACCCGGCGGG - Intergenic
1106157469 13:27171708-27171730 CCGCGGGCTGCGGTGCGAGCGGG - Exonic
1106956275 13:34942468-34942490 CCGCGGGGGGCGGGCCGGGCCGG + Exonic
1110782443 13:79481546-79481568 CGGCGGGAGGCAGTCCCGGGAGG - Intronic
1112344208 13:98576874-98576896 CCTCGGGCGGCGGGGCCGGCCGG + Intronic
1113312046 13:109141012-109141034 GCGCGGGGGGCGGCCCGGGCGGG - Exonic
1114155535 14:20099296-20099318 CCCGGGGCGGCGGTGCGGGCTGG - Intergenic
1114224213 14:20723483-20723505 CCGCGGGCAGAGGTGGCGGCGGG + Intergenic
1115502245 14:34060237-34060259 CGGCGGGCGGCGGCCGGGGCTGG + Intronic
1115664648 14:35534106-35534128 ACGCGGGCCGGGGTCCCGCCGGG - Exonic
1117183665 14:53217773-53217795 CCCGGGCCGGCGGTGCCGGCGGG + Intergenic
1118808884 14:69259905-69259927 CCGCGGGCGTCTGTCTCGCCGGG + Intronic
1119318301 14:73713894-73713916 CTGCAGGCGGCGGACCCGACCGG - Exonic
1119779860 14:77270580-77270602 CCGCGGGAGGGGATCCCGCCCGG + Intronic
1128528991 15:68431527-68431549 CCGGGCGCGGCGGCCCCGGAGGG - Intronic
1128594101 15:68929146-68929168 GCGCGGCCGGCCGTCCCCGCTGG - Intronic
1129299212 15:74615815-74615837 CCACGGGCGGAGGTCGCAGCCGG + Exonic
1129334283 15:74843140-74843162 CTGCGGGCGGCGGTTCCGGCGGG + Exonic
1129986461 15:79923497-79923519 CCGCGGGCGGCGGAGGCAGCGGG - Exonic
1132499875 16:280554-280576 GCGCGGGGGGCGCTCCCGGCCGG + Intronic
1132578753 16:675745-675767 CCGGGGTCGGCGGCCGCGGCCGG - Exonic
1132599040 16:765759-765781 CCTCCGGCCGCGGTTCCGGCGGG + Exonic
1132667588 16:1089267-1089289 CTGGGGGTGGGGGTCCCGGCTGG - Intergenic
1133188426 16:4116279-4116301 GGGCGGGCGGGCGTCCCGGCCGG - Intergenic
1133784385 16:8963447-8963469 CGGCGGGCGGCGGCGGCGGCAGG + Exonic
1135572320 16:23558151-23558173 ACGCGGGCGGCGGCGCGGGCAGG + Exonic
1135607354 16:23836101-23836123 CCGCGGGCTGCGGGCCGGGGAGG - Exonic
1136129608 16:28211663-28211685 CCGCGGGGGTCGGGCCCGGGCGG - Exonic
1136779097 16:32885945-32885967 CCGCGGGCCCCGGTCGGGGCCGG - Intergenic
1137300499 16:47143899-47143921 CCGCGGGCGGAGCTGCCTGCCGG - Exonic
1137426384 16:48384857-48384879 GCCCGGGAGGCGGGCCCGGCCGG - Intronic
1138106500 16:54289659-54289681 CCCCGGGCTGCGGTGCGGGCCGG + Intergenic
1139402906 16:66696534-66696556 CCGCGCGAGGCGGCCCGGGCCGG - Exonic
1139754611 16:69132455-69132477 CCGCGGGCGGGGGGCACGGGAGG - Intronic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1141116798 16:81315631-81315653 CCGCAGGTGCGGGTCCCGGCCGG - Intronic
1141957614 16:87383308-87383330 GCGGGGGCGGTGGCCCCGGCCGG - Intronic
1142079961 16:88143750-88143772 TTGCGGGGAGCGGTCCCGGCTGG + Intergenic
1142364944 16:89645270-89645292 CAGCAGGCTGCGGTCCCAGCGGG - Exonic
1142378771 16:89720629-89720651 CCGCGGCCCGGGATCCCGGCTGG + Intronic
1142378798 16:89720698-89720720 CCCCGGGCGGGGGTCCCTCCAGG + Intronic
1142389156 16:89787231-89787253 CCGCGCCCGGCCGTCCTGGCTGG - Intronic
1143150935 17:4807377-4807399 CCGGGGGCAGGGGTCCAGGCGGG - Intronic
1143387186 17:6538051-6538073 CCCCGGGCGGCGGTGCCCCCTGG - Exonic
1143496418 17:7315224-7315246 ACTGGGGCTGCGGTCCCGGCCGG - Intronic
1145912801 17:28552307-28552329 CCGCGGGCGGCGCTCCCTCGCGG + Intronic
1146057694 17:29589423-29589445 GCGCGGGCGGCGGGCCCGGGCGG + Exonic
1146062264 17:29613588-29613610 GCGCTGGCGAGGGTCCCGGCAGG - Exonic
1146064272 17:29622647-29622669 CCGCTGGCTGCGGTGACGGCCGG + Intronic
1147264361 17:39225836-39225858 CAGCGGACGGCGGAGCCGGCTGG - Exonic
1147400553 17:40177983-40178005 GCGGGGGCGGCGGTCCAGCCGGG + Intronic
1149678504 17:58487746-58487768 CCGCGGGCGGCGGCGGCTGCTGG + Exonic
1151875959 17:76868481-76868503 GCGCGGGCGGCGGAGCCAGCGGG + Intronic
1152072733 17:78142001-78142023 CAGCGGGCGGGGGCCCAGGCAGG + Exonic
1152349792 17:79778170-79778192 GGGCGCGCGGCGGTCCGGGCGGG + Exonic
1152349820 17:79778318-79778340 CGGCGGGCGGGGGGCCCGGCGGG - Intronic
1152614521 17:81331632-81331654 CCGGGGGCGGCCGACCCAGCTGG - Intergenic
1152699723 17:81812957-81812979 CCCCGGGCGGGGGAGCCGGCGGG - Intronic
1152728743 17:81959960-81959982 GCGCGGGCGGCGGTCCTCCCGGG + Intronic
1153794477 18:8609691-8609713 CGGCGGGCGGCGGGCCGAGCGGG + Exonic
1156275816 18:35581797-35581819 CCGGCCGCGGCGGTCGCGGCCGG - Intronic
1157609645 18:48948665-48948687 CCGCGCTCGGCTGGCCCGGCTGG + Intronic
1157610009 18:48950254-48950276 CCGGTGGCGGCGGCCCGGGCAGG - Exonic
1158435947 18:57435679-57435701 CCGGGGGCGGCGGGGGCGGCGGG - Exonic
1160738710 19:676336-676358 CCGCGGGCCGCGGGCGGGGCGGG - Intergenic
1160831925 19:1108274-1108296 CGGCGGGCGGTGGTCCCGAGCGG - Exonic
1160847852 19:1174185-1174207 CCGCGGGCTCCGCGCCCGGCCGG - Exonic
1160862157 19:1242014-1242036 CCGGGGGCGGCGGCCACGGAGGG - Intronic
1160907221 19:1457013-1457035 CCGCGGCCGGGGGTCGCGCCGGG + Exonic
1160910006 19:1469941-1469963 CCGCCGGCGGGGGCCCCGGGGGG - Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161802632 19:6424546-6424568 CCGGCGGCGGCGGCCCGGGCGGG - Exonic
1162311997 19:9913447-9913469 GCGCGGGGGGCGCTCCCGGGGGG - Intronic
1162470954 19:10871745-10871767 GCGGGGTCGGCGGTCCCGGGCGG + Exonic
1162744180 19:12789813-12789835 CCGGGGGCGGCGGTCGGGGCTGG + Intronic
1162914191 19:13865488-13865510 CCGCGGGCAGGGGGCGCGGCGGG + Intronic
1163154425 19:15432361-15432383 TCGGGGGCGGCGGCACCGGCAGG + Intronic
1163262210 19:16198106-16198128 CCGCGGGCGGAGGCCCCTGCCGG - Intronic
1163581956 19:18144547-18144569 CCCAAGGCGGCGGCCCCGGCCGG - Exonic
1165415541 19:35691321-35691343 CCGGGGCCGGCGGGGCCGGCCGG + Intergenic
1165928698 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG + Intronic
1167072327 19:47228214-47228236 CCCAGGGCGGCGGTGACGGCGGG + Exonic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167428409 19:49441418-49441440 CCGCGGGCGGGGGGATCGGCGGG - Exonic
1167578328 19:50328315-50328337 ACGCGGGCGGCGGCGCCGGGGGG - Exonic
1167738788 19:51311938-51311960 CCGGGGGCGGGGGGCTCGGCCGG + Intronic
1168290445 19:55354716-55354738 CCGCGGGGTGCGGTCCCACCCGG + Exonic
1168332522 19:55578646-55578668 CCGCGGGCAGCGGGGCCAGCAGG + Exonic
1168408037 19:56120917-56120939 CCGCGGGCGGCGAGCGGGGCTGG - Intronic
926095893 2:10080372-10080394 TCCCGGGCGGGGGTCGCGGCCGG + Exonic
927606427 2:24491046-24491068 CCTCGCTCGGCGGGCCCGGCAGG + Intergenic
927942199 2:27111730-27111752 CCGGGGCCGGCGGGGCCGGCCGG + Intronic
929126596 2:38528188-38528210 CCGCGGGCTGCGGTGCGAGCTGG + Intergenic
929857904 2:45651436-45651458 CAGGAGGCGGCGGCCCCGGCTGG + Intronic
930156419 2:48111739-48111761 CCCCGGCCGGCGCCCCCGGCTGG + Intergenic
933278145 2:80304258-80304280 CCGCGGCCGGCGGATCTGGCAGG + Exonic
933655259 2:84881274-84881296 AGGTGGGCGGCGGCCCCGGCAGG - Intronic
933666740 2:84970945-84970967 CCGCGGCCGGCGGTCGCGACGGG - Intergenic
935112456 2:100105237-100105259 CCGCGGGCGGCGGACCCGGGTGG + Intronic
935237486 2:101151054-101151076 CTGGGGGCCGCGGGCCCGGCGGG + Intronic
935918762 2:107986712-107986734 CAGGGGGCGGCGGCCCCGGGCGG + Exonic
938500624 2:131829917-131829939 CCGGGGGCGGTGGCTCCGGCAGG + Intergenic
939053232 2:137331870-137331892 CCGGGGCCGGCGGGGCCGGCCGG + Intronic
939990885 2:148875934-148875956 CCGGGAGCGGCGGGCCGGGCGGG + Intronic
940354043 2:152718787-152718809 CTGCGGGCGGAGTTCTCGGCTGG + Exonic
942046516 2:172102299-172102321 CGGCGGGCGGCGGCGGCGGCGGG - Exonic
942799641 2:179861063-179861085 CCGGGGGCGCCGGTCTGGGCTGG + Intronic
944221764 2:197310554-197310576 TAGCGGGCGGCGGCGCCGGCGGG - Intronic
945955416 2:216081874-216081896 CCGCGGCCGGCGGGCGGGGCGGG - Exonic
946019876 2:216633688-216633710 CGGCGGGCGGCGCAACCGGCGGG - Exonic
946921256 2:224584664-224584686 CCGCGGGCGTCGGCTGCGGCCGG - Intronic
947592954 2:231395649-231395671 CCGCGGGAGGAGGGGCCGGCAGG - Exonic
947612034 2:231530481-231530503 CCCCTGGCGGCGTTCCCGGCCGG - Exonic
948140491 2:235669541-235669563 CCGCGGGCCGCGCGCCCAGCCGG - Intronic
948140866 2:235670847-235670869 GCGCGGGCGGCGGCCGGGGCCGG + Intronic
948449129 2:238058116-238058138 CCGGGGCCGGCGGGGCCGGCTGG + Intronic
949080002 2:242088925-242088947 CCGGGGGCGGCGGGCGCGTCAGG + Intergenic
1170889128 20:20364441-20364463 CCGCGGGCGGGAGGCCCGGAAGG + Intergenic
1171427388 20:25057538-25057560 CCGCGGGCGCCGGCCCGAGCTGG + Intronic
1172118518 20:32584894-32584916 CCGAGGGCGCCGGGCGCGGCGGG - Intronic
1172771813 20:37386491-37386513 CCGTGGGCGGCGGGCTGGGCGGG + Intronic
1173778750 20:45735995-45736017 CCAGGGCCGGCGGTGCCGGCCGG - Intergenic
1174246849 20:49188139-49188161 CCCCGGCCGGCGGTCCTGGGCGG + Exonic
1174258795 20:49278261-49278283 CCCCCGGCGGCGGAGCCGGCGGG + Intronic
1174373967 20:50113080-50113102 GCGGGGGCGCCGGGCCCGGCCGG - Intronic
1174386665 20:50191525-50191547 CGGCGGGCGGCGGCGGCGGCGGG - Exonic
1175107475 20:56625636-56625658 CGGCGGGCGGGGGTCCCCCCCGG + Intergenic
1176569430 21:8401998-8402020 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1178104147 21:29299304-29299326 CCGCGGGCGAGGGGCCGGGCTGG - Intronic
1178555670 21:33588378-33588400 CCGCGGTCGGTTGTCCAGGCGGG + Exonic
1178610188 21:34073371-34073393 CCGCGGCCGGCGGGCTGGGCTGG + Intronic
1179457055 21:41507393-41507415 CCGCTGGCGGCGATCAGGGCCGG - Intronic
1179610663 21:42547985-42548007 ACGCGGGCGACGGGCCCAGCAGG - Intronic
1180005606 21:45019107-45019129 CAGCGGGCGGGGGTCCTGCCCGG - Intergenic
1180961935 22:19766181-19766203 CTGCGGGCGGCGGCGGCGGCGGG - Intronic
1183211652 22:36455082-36455104 CCGCGGACGGCGGACTGGGCCGG + Intergenic
1183393823 22:37560634-37560656 CCGCGGGCGCCGGGACCCGCCGG - Intronic
1183586402 22:38755601-38755623 GCGCGGGCCGCGGACCCGGGTGG + Intronic
1183586487 22:38755848-38755870 CCGCGGGCGGCGCTCCGCTCAGG + Exonic
1183665140 22:39242556-39242578 CCGCGGGGGGCGGCCGCGGAAGG + Intronic
1184680863 22:46071537-46071559 CCGCGGGCTGCGGGGCCCGCAGG + Intronic
951717482 3:25664603-25664625 CCGCGGGCGCCGCTGCAGGCCGG + Intronic
953657074 3:44862263-44862285 CCGCGGCCCGGGGCCCCGGCGGG - Intronic
954004155 3:47578661-47578683 CCGGGGGCGGGGGCCCGGGCCGG - Exonic
956678027 3:71753681-71753703 GCGGCGGCGGCGGGCCCGGCGGG + Intronic
956678185 3:71754287-71754309 CGGCGTGCGGCGGCCGCGGCGGG + Exonic
956681480 3:71785349-71785371 ACGCAGGCAGCGCTCCCGGCGGG + Intergenic
957419684 3:79951633-79951655 CCGGGGCCGGCAGTGCCGGCCGG + Intergenic
961182326 3:124886859-124886881 CCGCGGGCGGGCGTCTCGGAGGG - Intronic
966096806 3:176213681-176213703 CCCGGGGCGGCGGGGCCGGCAGG + Intergenic
966181896 3:177196548-177196570 CCGGGCGCGGCGACCCCGGCCGG - Intronic
966696240 3:182793416-182793438 GCGCCGGGGGCGGTCCCGGGTGG + Intergenic
968433823 4:575201-575223 CCGGGGCCGGCGGGGCCGGCGGG - Intergenic
969379420 4:6783692-6783714 GCGCGGGGGGCGGGCCTGGCGGG + Intronic
969716687 4:8871378-8871400 TCGCGGGCACCGGGCCCGGCGGG - Exonic
969716781 4:8871724-8871746 CCGCTGGCGTCGGGCCCCGCAGG + Exonic
970574592 4:17414549-17414571 CCGGGGCCAGCGGTGCCGGCAGG + Intergenic
971030771 4:22634866-22634888 CCGGGGTCGGCAGTGCCGGCCGG - Intergenic
971405623 4:26319474-26319496 CGGCGGGCGGCGGGCGCGGGCGG - Intronic
973894238 4:55396163-55396185 CCGTGCGCGGCCGGCCCGGCAGG + Exonic
973954452 4:56049235-56049257 CGGCGACCGGCGGTCCCGGGCGG - Intergenic
974047270 4:56908350-56908372 CCGGCGGCGGCGGCCCCGCCGGG + Intronic
975616396 4:76251755-76251777 CCGCAGGCGGCGGCTCCGGCCGG + Exonic
976704794 4:88008380-88008402 CAGCGGGCGATGGCCCCGGCCGG - Intronic
977606950 4:98993748-98993770 CCGAGGCCGGCGGGGCCGGCCGG + Intergenic
979224173 4:118265656-118265678 CCGGGGCCGGCGGGGCCGGCTGG - Intergenic
979674671 4:123398330-123398352 CCGCGGGGAGCGCTCCTGGCCGG + Intronic
980075432 4:128288325-128288347 CCGCGGGGGCAGGTCCGGGCTGG + Exonic
982157214 4:152535275-152535297 CCGAGGGCGGCGGGGCCGGGGGG - Exonic
985590874 5:764460-764482 CCGGGGCCGGCAGTGCCGGCCGG - Intronic
985616564 5:926573-926595 GCGCGGACGGCGGCCCCCGCAGG - Intergenic
989043152 5:37249427-37249449 CCGCCCGCGGCGTTCCCGGCCGG - Exonic
989178853 5:38556635-38556657 CCGCGCGCCGCAGTCCCGGCTGG - Intronic
992105851 5:73448437-73448459 TCCCGGGCGGCAGGCCCGGCCGG + Intergenic
994670269 5:102755164-102755186 GGGCGAGCGGCGGACCCGGCTGG + Intronic
996443087 5:123512824-123512846 CCGCGGGTGGCGGGTCGGGCTGG + Intronic
997560970 5:134846016-134846038 CCGTGCGCGGCGGCCGCGGCGGG + Exonic
1000319031 5:160119163-160119185 CCGGCGGCGGCGGTGGCGGCGGG + Exonic
1001375384 5:171251721-171251743 CCGCGGGCTGCGGTGCGAGCAGG + Intronic
1001841530 5:174880767-174880789 CCGGGGCCGGCGGCACCGGCCGG - Intergenic
1002131879 5:177086963-177086985 CCGCGTGCAGGGGTCGCGGCCGG + Exonic
1002487768 5:179551048-179551070 CTGCGGGGGGCGGTCTCGGCTGG - Intronic
1002896710 6:1383952-1383974 CCGAGGGCGGCGAACTCGGCGGG - Intergenic
1003062854 6:2876147-2876169 CCGTGGGCGGCGGGCGCCGCAGG + Intergenic
1003139080 6:3456512-3456534 CGGCGGGCGGCGGGCCTGGGCGG - Exonic
1003897023 6:10617278-10617300 CCCCGGGCGGCGGGGCCGGCCGG + Intronic
1004906201 6:20239162-20239184 CCGGGGCCGGCGGGGCCGGCCGG - Intergenic
1006121154 6:31806768-31806790 CCGCGGGCAGCGGGCCGGACCGG + Exonic
1006787523 6:36678603-36678625 CCGGGGAGGGCGGTCCCGGGCGG + Intronic
1006891569 6:37433452-37433474 CCGCGGGCGGGGGGCCCAGGCGG - Intronic
1007327479 6:41073276-41073298 CCGCGCGGGGCGGCCCCTGCAGG - Intronic
1012450572 6:99349557-99349579 CCGCGGACGGCGGGCCTGGCCGG + Exonic
1014272323 6:119349006-119349028 CCGCGGGCGGCGTCCTGGGCGGG - Exonic
1015149231 6:130019868-130019890 GCGCGGGCCGCGGGCCGGGCCGG + Intronic
1015315014 6:131807934-131807956 CCGCGAGGGGCGGGCGCGGCGGG + Intergenic
1015880662 6:137867413-137867435 CCGCAGGCGGGGGTCGGGGCAGG - Exonic
1016996216 6:149963949-149963971 CTGCGCGCGGCGGGCCGGGCTGG + Intergenic
1017793709 6:157823327-157823349 GCGAGGGCGGCGGCTCCGGCTGG - Exonic
1018619346 6:165715077-165715099 TCTCGGGCGGCCGTCCCTGCAGG - Intronic
1018686607 6:166308363-166308385 CGGCGGGAGGCGGTTCCTGCAGG - Exonic
1019395816 7:816988-817010 CCGCGGCGGGCGGCCCGGGCTGG + Intronic
1019539298 7:1544592-1544614 CAGCGTGGGGCGGTCCAGGCCGG - Exonic
1019828196 7:3301151-3301173 CGGCGGGCGGCGGGCGCGGGCGG + Intergenic
1020004557 7:4775486-4775508 CCGCGGCCGGGGGTCCGGGTCGG - Intronic
1022101849 7:27173712-27173734 CGTCGGGCGGCGGGCCCCGCGGG + Exonic
1023360940 7:39414555-39414577 CCGCGGGCGGCGGACTTGACAGG + Intronic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1024741767 7:52362750-52362772 CCCTGGGCGGCGGGGCCGGCTGG - Intergenic
1025069778 7:55887835-55887857 CGGCGGGCGGCGGCGGCGGCGGG + Intronic
1025069796 7:55887883-55887905 CGGCGGGCGGCGGCGGCGGCGGG + Intronic
1025992251 7:66505035-66505057 CCGCGGGCAGAGGCCCCGCCCGG + Intergenic
1027238023 7:76309698-76309720 CCGGGGCCGGCGGGGCCGGCCGG + Intergenic
1027421136 7:78019425-78019447 CCGGGGGTCGCGGGCCCGGCCGG + Exonic
1028796339 7:94907910-94907932 CCGCGGCGGGCGGCCCCGGGAGG - Intronic
1029640565 7:101816838-101816860 CCGGGGGCGGCGGCCGGGGCCGG - Intronic
1030033578 7:105389245-105389267 CAGCGGGCGGCGCGACCGGCCGG - Intronic
1032074567 7:128830335-128830357 CCGGGGGCCGCGGGCGCGGCGGG + Intergenic
1032083064 7:128869647-128869669 CCGCCGGCGGCGCTGCCGCCTGG + Intronic
1035431786 7:158828704-158828726 CAGCGGGCGGCGGCCCCAGGCGG + Intronic
1035538040 8:407190-407212 CCGGGGGCGGCGGGCGCGTCAGG + Intronic
1036928665 8:12931566-12931588 CCGGGGCCGGCAGTGCCGGCCGG + Intergenic
1037273814 8:17156750-17156772 CGCCAGGCGGCGGTGCCGGCGGG + Exonic
1038041447 8:23727128-23727150 GGGCGGGCGGCGGCCCCGGGCGG + Intergenic
1039542334 8:38382325-38382347 CCGCGGGCCGCGGCGCCTGCCGG + Intergenic
1041044297 8:53877281-53877303 CCACGGGCGGCAGGGCCGGCGGG - Intronic
1042837725 8:73092972-73092994 CCGGGCGCTGCTGTCCCGGCCGG - Exonic
1043463953 8:80486951-80486973 GCGCGGGCGGCGCTGGCGGCGGG - Exonic
1043502978 8:80874388-80874410 CCGCGCGCGCCTCTCCCGGCCGG + Intronic
1046547439 8:115669123-115669145 CGGCCGGGGCCGGTCCCGGCGGG - Intronic
1047615397 8:126558439-126558461 CCACGGGCTGCGCTCCCGCCCGG - Intergenic
1049177926 8:141205760-141205782 CCGAGGGCGGGGGTCCTGGTGGG + Intergenic
1049585397 8:143430490-143430512 CCGCGGGCGGCGGTCCCGGCGGG + Intergenic
1049585469 8:143430708-143430730 CCGTGGGAGGCGGGGCCGGCCGG - Intergenic
1049708171 8:144052240-144052262 GCGCGGGCGCGGGTCCCAGCTGG - Exonic
1049724224 8:144138064-144138086 GCGCGGGCGGCGTCCCGGGCCGG - Exonic
1049732434 8:144185615-144185637 CCGCGGGGGGCGGTGAGGGCCGG + Intronic
1050873978 9:10612905-10612927 CCGCCGGCTGCGGGCGCGGCTGG + Intergenic
1052971741 9:34380926-34380948 CCGCAGGCGGCGGTCGGTGCAGG + Exonic
1053284720 9:36842770-36842792 AAGGGGGCTGCGGTCCCGGCAGG - Intronic
1054798539 9:69325084-69325106 CAGCGGGAGGCGGACCCGCCAGG + Intronic
1054820455 9:69516222-69516244 CAGCGGGCGGTGGGCCCCGCGGG - Exonic
1057139732 9:92719138-92719160 CCGCGAGCTGCTGGCCCGGCTGG - Exonic
1057488937 9:95507372-95507394 GCGCTGGCCGCGGCCCCGGCGGG + Intronic
1057921935 9:99104981-99105003 CCGCAGGCGGGGCTCCCGGCTGG + Intronic
1059446607 9:114342084-114342106 CAGCGGGAGGCGGTCCCAGTGGG + Exonic
1060105137 9:120868838-120868860 CCTCGGGAGGCGGGCCTGGCGGG - Intronic
1060105153 9:120868879-120868901 CCTCGGGGGGCGGGCCCGGAAGG - Intronic
1061449785 9:130661721-130661743 CCCCGGGCGGGGGTCCAGGTGGG + Intergenic
1061725542 9:132580346-132580368 CCTCCCGCGGCGGTCCGGGCCGG - Intergenic
1062230527 9:135479609-135479631 TCGCGGGCGGGGGTCCGGCCGGG + Intronic
1062476224 9:136728691-136728713 AGGCGGGCGAGGGTCCCGGCAGG + Intergenic
1062517812 9:136944869-136944891 CAGCGGGCGGCGGTCGTGGGCGG + Intronic
1062596358 9:137301559-137301581 CCGGGGTCCGGGGTCCCGGCGGG + Exonic
1062596422 9:137301940-137301962 GCGCGGGCCGCGGGCCGGGCCGG + Exonic
1062596501 9:137302159-137302181 TCGCGGGGGCCGGGCCCGGCCGG + Exonic
1062696344 9:137877995-137878017 CCCGGGGCGGCGGGGCCGGCGGG + Exonic
1203471795 Un_GL000220v1:118435-118457 GCGCGTGCGGGGGGCCCGGCGGG + Intergenic
1187018217 X:15351407-15351429 CCGCGCCCGGCCGGCCCGGCTGG + Intronic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190554388 X:51618666-51618688 CCGGTGGCGGCGGGCCCGGGAGG - Intergenic
1190560690 X:51682624-51682646 CCGCTGGCGGCGGGTCCGGAAGG - Intergenic
1190563601 X:51710697-51710719 CCGCTGGCGGCGGGTCCGGAAGG + Intergenic
1199721857 X:150547877-150547899 GCGCGGCCGCCGGTCCCAGCCGG + Intergenic
1200036467 X:153334590-153334612 CGGGGGGCGGCGATCCCGGGTGG + Intronic
1200045945 X:153401084-153401106 TGGGGGGCGGCGGTCCCGCCTGG - Intergenic
1200277821 X:154751049-154751071 CCGCGGGCGGCTGGCCCAGCTGG - Exonic