ID: 1049585470

View in Genome Browser
Species Human (GRCh38)
Location 8:143430708-143430730
Sequence CCGGCCGGCCCCGCCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049585463_1049585470 -9 Left 1049585463 8:143430694-143430716 CCCCACCCGCGCCGCCGGCCGGC No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585459_1049585470 -3 Left 1049585459 8:143430688-143430710 CCCGCGCCCCACCCGCGCCGCCG No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585464_1049585470 -10 Left 1049585464 8:143430695-143430717 CCCACCCGCGCCGCCGGCCGGCC No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585453_1049585470 26 Left 1049585453 8:143430659-143430681 CCGCCGCCTCGGGCTGCTCCGGG No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585457_1049585470 8 Left 1049585457 8:143430677-143430699 CCGGGACCGCTCCCGCGCCCCAC No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585456_1049585470 20 Left 1049585456 8:143430665-143430687 CCTCGGGCTGCTCCGGGACCGCT No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585458_1049585470 2 Left 1049585458 8:143430683-143430705 CCGCTCCCGCGCCCCACCCGCGC No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585455_1049585470 23 Left 1049585455 8:143430662-143430684 CCGCCTCGGGCTGCTCCGGGACC No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data
1049585460_1049585470 -4 Left 1049585460 8:143430689-143430711 CCGCGCCCCACCCGCGCCGCCGG No data
Right 1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049585470 Original CRISPR CCGGCCGGCCCCGCCTCCCA CGG Intergenic
No off target data available for this crispr