ID: 1049587603

View in Genome Browser
Species Human (GRCh38)
Location 8:143439225-143439247
Sequence ACGGCTCCACGCCCCTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049587590_1049587603 27 Left 1049587590 8:143439175-143439197 CCAGATGGAGGGAGCGGGTGCCC 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1049587603 8:143439225-143439247 ACGGCTCCACGCCCCTGACGTGG No data
1049587597_1049587603 7 Left 1049587597 8:143439195-143439217 CCCAGGTCTCGTGGGGCGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1049587603 8:143439225-143439247 ACGGCTCCACGCCCCTGACGTGG No data
1049587589_1049587603 28 Left 1049587589 8:143439174-143439196 CCCAGATGGAGGGAGCGGGTGCC 0: 1
1: 0
2: 1
3: 14
4: 198
Right 1049587603 8:143439225-143439247 ACGGCTCCACGCCCCTGACGTGG No data
1049587599_1049587603 6 Left 1049587599 8:143439196-143439218 CCAGGTCTCGTGGGGCGGAGGGT 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1049587603 8:143439225-143439247 ACGGCTCCACGCCCCTGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049587603 Original CRISPR ACGGCTCCACGCCCCTGACG TGG Intronic
No off target data available for this crispr