ID: 1049592417

View in Genome Browser
Species Human (GRCh38)
Location 8:143468680-143468702
Sequence GGTCATAGCAGGCCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049592405_1049592417 16 Left 1049592405 8:143468641-143468663 CCTGCAGGATCCAGCCGGCCTGT 0: 1
1: 0
2: 2
3: 5
4: 137
Right 1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG 0: 1
1: 0
2: 1
3: 33
4: 404
1049592412_1049592417 2 Left 1049592412 8:143468655-143468677 CCGGCCTGTGGGGGAGAGAGGCA 0: 1
1: 0
2: 1
3: 45
4: 425
Right 1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG 0: 1
1: 0
2: 1
3: 33
4: 404
1049592410_1049592417 6 Left 1049592410 8:143468651-143468673 CCAGCCGGCCTGTGGGGGAGAGA 0: 1
1: 0
2: 1
3: 16
4: 546
Right 1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG 0: 1
1: 0
2: 1
3: 33
4: 404
1049592414_1049592417 -2 Left 1049592414 8:143468659-143468681 CCTGTGGGGGAGAGAGGCACGGG 0: 1
1: 0
2: 0
3: 23
4: 263
Right 1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG 0: 1
1: 0
2: 1
3: 33
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049592417 Original CRISPR GGTCATAGCAGGCCACAGCC TGG Intronic
900462923 1:2810000-2810022 GGGCCCAGCAGGCCACAGCACGG + Intergenic
901262868 1:7886199-7886221 GCTGATAGCAGGAGACAGCCGGG - Intergenic
901671007 1:10856469-10856491 GGGCATGGCGGGGCACAGCCAGG + Intergenic
901841569 1:11957112-11957134 GTTCATAGCAGGCCCCAGGAAGG - Intronic
902592710 1:17486407-17486429 GTTCCTAACAGGCCACAGACAGG - Intergenic
902600127 1:17535381-17535403 GTTCCTAACAGGCCACAGCCTGG + Intergenic
902784979 1:18727451-18727473 GGTAAATGAAGGCCACAGCCAGG + Intronic
902803830 1:18848539-18848561 GTTCCTAACAGGCCACAGACTGG - Intronic
903442925 1:23401791-23401813 GTTCCTAACAGGCCACAGACTGG - Intronic
903703827 1:25270325-25270347 GTTCCTAACGGGCCACAGCCTGG - Intronic
903723416 1:25422999-25423021 GTTCCTAACGGGCCACAGCCTGG + Intronic
905601613 1:39256818-39256840 GGTGAGAGCAGGCCAAAGACTGG + Intronic
905763581 1:40581404-40581426 GTTCCTAACAGGCCACAGACTGG - Intergenic
906185075 1:43856387-43856409 GGTCATAGTAGCACAGAGCCAGG + Intronic
906684959 1:47757334-47757356 GCTCATAGCAGCCGCCAGCCAGG - Intergenic
907057455 1:51383661-51383683 GTTCCTAACAGGCCACAGACTGG + Intronic
907222686 1:52918877-52918899 GTTCCTAGCAGGCCACAGACTGG - Intronic
908172183 1:61516297-61516319 GTTCCTAACAGGCCACAGACTGG - Intergenic
908309032 1:62857145-62857167 GTTCCTAACAGGCCACAGACTGG - Intronic
908343399 1:63205874-63205896 GTTCTTAACAGGCCACAGACTGG - Intergenic
909221601 1:72969310-72969332 GTTCCTAACAGGCCACAGACAGG + Intergenic
910953744 1:92679004-92679026 GTTCCTAACAGGCCACAGACTGG - Intronic
912216412 1:107618189-107618211 GTTCCTAACAGGCCACAGTCTGG + Intronic
912415174 1:109503424-109503446 GGTCAAACCAGCCCACTGCCTGG + Intergenic
912498436 1:110106311-110106333 GGTCACAGCAGGCTACAGCCCGG + Intergenic
913250004 1:116905548-116905570 GGGCATAGCAGGTCAGAGACAGG + Intergenic
915147155 1:153802000-153802022 GGTGAGAGCAGCCCACTGCCTGG + Intergenic
915216631 1:154344764-154344786 GGTCATAAATGGTCACAGCCTGG + Exonic
916245806 1:162687092-162687114 GGCCAGAGCAGCCCAAAGCCTGG - Intronic
916303573 1:163303695-163303717 GTTCCTAACAGGCCACAGACCGG - Intronic
916664102 1:166949837-166949859 GGGCAGAGCAGGCCAAAGCTAGG + Intronic
916705660 1:167346736-167346758 GTTCCTAGCAGGCCACAGATTGG + Intronic
917098947 1:171426786-171426808 GTTCCTAACAGGCCACAGACTGG + Intergenic
918287556 1:183072640-183072662 GTTCCTAACAGGCCACAGACTGG - Intronic
918432698 1:184478568-184478590 GTTCACTGGAGGCCACAGCCTGG - Intronic
918811144 1:189122698-189122720 GTTCCCAGCAGGCCACAGGCTGG - Intergenic
922617713 1:226972963-226972985 GGCCACAGCAAGCCACAGCCAGG - Intronic
923142428 1:231172019-231172041 AATCATAGCACACCACAGCCTGG - Intronic
923618421 1:235557090-235557112 GTTCCTAACAGGCCACAGACTGG + Intronic
923704427 1:236332526-236332548 GTTCCTAACAGGCCACAGACTGG - Intergenic
924030179 1:239878508-239878530 GTTCCTAACAGGCCACAGACTGG + Intronic
924516085 1:244767691-244767713 GGTTATAGCAGGCCACGGGTGGG - Intergenic
1063460838 10:6214119-6214141 CAACATAGCAGTCCACAGCCTGG - Intronic
1064030820 10:11881576-11881598 AGGAATAGCTGGCCACAGCCAGG - Intergenic
1065368398 10:24956778-24956800 GTTCCTAACAGGCCACAGGCTGG - Intergenic
1065666142 10:28063541-28063563 GTTCCTAACAGGCCACAGACTGG - Intronic
1067139228 10:43642435-43642457 GTTCCTAACAGGCCACAGACTGG - Intergenic
1068163531 10:53299036-53299058 GTTCCTACCAGGCCACAGACTGG + Intergenic
1068544294 10:58328518-58328540 GTTCCTAACAGGCCACAGACTGG + Intergenic
1068630066 10:59289286-59289308 GGTCCTAACAGGCTACAGGCCGG + Intronic
1069136470 10:64772918-64772940 GTTCCTAACAGGCCACAGACTGG - Intergenic
1070783484 10:79150355-79150377 GGTCAGCGCAGGCCAGAGGCAGG - Intronic
1071456121 10:85852838-85852860 GGACATTGCAGGTCACACCCTGG + Intronic
1072681758 10:97512668-97512690 TGTCACAGCAGGACACAGCTAGG - Intronic
1073542047 10:104322626-104322648 TGTCACAGCAGCCCACATCCTGG + Intronic
1074139609 10:110660440-110660462 GTTCCTAACAGGCCACAGCCTGG - Intronic
1074704503 10:116119020-116119042 GGTCATAGCTGGCTCCTGCCTGG + Intronic
1075395115 10:122121469-122121491 GGTGATAGGAGGCCAGAGCCCGG - Intronic
1075778622 10:125003301-125003323 GGTCAGTGCAGGCCCCGGCCGGG + Intronic
1076403228 10:130196736-130196758 GGACACAGCAGGCCACAGTGTGG + Intergenic
1076621200 10:131789221-131789243 GCTCCTAACAGGCCACAGACTGG - Intergenic
1077373345 11:2193845-2193867 GTTCATAGCAGCCCCCAGCGAGG - Intergenic
1078190352 11:9089043-9089065 GTTCATAGCTGGCCAGAGACTGG - Intronic
1078292335 11:10025333-10025355 GACCATAAAAGGCCACAGCCTGG - Intronic
1078463212 11:11531013-11531035 CCTCAGAGCAGGCCTCAGCCTGG - Intronic
1078628035 11:12976359-12976381 GGTGAATGCAGGCCACATCCTGG - Intergenic
1078734518 11:14007741-14007763 GCTCCTAACAGGCCACAGACTGG + Intronic
1078812660 11:14783889-14783911 GTTCCTAACAGGCCACAGACCGG - Intronic
1078949705 11:16116719-16116741 GTTCCTAACAGGCCACAACCTGG - Intronic
1079356886 11:19737188-19737210 GGTCAGAGCAAGGAACAGCCTGG + Intronic
1080551455 11:33376548-33376570 GGGCATCGCCGGCCACGGCCCGG - Intergenic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1083149701 11:60784066-60784088 GTTCCTAACAGGCCACAGACTGG - Intergenic
1083914481 11:65731642-65731664 GATCATATCAGGCCTGAGCCTGG + Intergenic
1084899740 11:72300679-72300701 TGTCATAGGAGGCCACAGGGAGG - Intronic
1085121350 11:73969483-73969505 GGTGATTGCAGCCCACAGCTTGG - Intronic
1085382710 11:76134884-76134906 GTTCTTAACAGGCCACAGACGGG - Intronic
1087812485 11:102623290-102623312 GTTCCTAACAGGCCACAGACTGG - Intronic
1088329616 11:108637365-108637387 GGTCAGAGAAGGCCACAGTAAGG + Intergenic
1088341463 11:108772642-108772664 GTTCCTAACAGGCCACAGACCGG - Intronic
1088906606 11:114159876-114159898 GGTTCAAGCAGCCCACAGCCTGG + Intronic
1088918350 11:114243836-114243858 GGTCAGAGCAGGGCACATCCTGG - Intronic
1089095137 11:115913793-115913815 GTTCCTAACAGGCCACAGACTGG - Intergenic
1089101323 11:115965112-115965134 GTTCCTAACAGGCCACAGACTGG + Intergenic
1090901646 11:131037568-131037590 GTTCCTAACAGGCCACAGACCGG + Intergenic
1091513986 12:1159466-1159488 GTTCCTAACAGGCCACAGACCGG + Intronic
1092194909 12:6543299-6543321 GTTCCTAACAGGCCACAGACAGG - Intronic
1094066185 12:26363035-26363057 GTTCCTAACAGGCCACAGACTGG - Intronic
1094075156 12:26464510-26464532 GTTCCTAACAGGCCACAGACTGG + Intronic
1095177595 12:39111100-39111122 GTTCCTAACAGGCCACAGACTGG - Intergenic
1095203080 12:39408414-39408436 GTTCCTAGCAGGCCACAGACTGG + Intronic
1095654333 12:44650979-44651001 GTTCCTAACAGGCCACAGACTGG - Intronic
1095914830 12:47467240-47467262 GTTCCTAACAGGCCACAGACTGG + Intergenic
1096431713 12:51549748-51549770 GTTCCTAACAGGCCACAGACAGG - Intergenic
1097005783 12:55916754-55916776 GGCCATTGCACTCCACAGCCTGG + Intronic
1097580896 12:61455034-61455056 GTTCCTAACAGGCCACAGCTTGG + Intergenic
1098658020 12:73057573-73057595 GGTCCTACCAGGCCACAGACTGG - Intergenic
1099195293 12:79608522-79608544 GCTCCTAACAGGCCACAGACAGG + Intronic
1099317776 12:81106107-81106129 GTTCCTAACAGGCCACAGACTGG - Intronic
1100813379 12:98362387-98362409 AGTCTTAGTTGGCCACAGCCTGG - Intergenic
1101374213 12:104157008-104157030 GTTCCTAACAGGCCACAGGCTGG + Intergenic
1102431396 12:112886567-112886589 GTTCCTAACAGGCCACAGACTGG + Intronic
1102960802 12:117092213-117092235 GCTCAAAGAAGGACACAGCCTGG + Intronic
1104427870 12:128693029-128693051 GGTCATAGAAGACCACAGAAGGG + Intronic
1104466122 12:128992393-128992415 GTTCCTAACAGGCCACAGGCCGG + Intergenic
1104538479 12:129640716-129640738 GCTCCTAACAGGCCACAGACTGG - Intronic
1105373333 13:19819960-19819982 GTTCCTAACAGGCCACAGCCAGG + Intergenic
1106457153 13:29937440-29937462 GTTCCTAACAGGCCACAGACTGG - Intergenic
1106832743 13:33602649-33602671 GTTCCTAACAGGCCACAGACCGG - Intergenic
1108608210 13:52061334-52061356 GTTCCTAACAGGCCACAGACTGG + Intronic
1110419071 13:75284575-75284597 GTTCATAACAGGCCACAGACAGG + Intergenic
1110754192 13:79152367-79152389 GTTCCTGGCAGGCCACAGACTGG - Intergenic
1112032999 13:95474426-95474448 GTTCCTAACAGGCCACAGACTGG + Intronic
1113393780 13:109923881-109923903 CTTCATGGCAGGTCACAGCCTGG - Intergenic
1113398192 13:109968401-109968423 GGGCTTTGCAGGCCACAGGCAGG + Intergenic
1113896739 13:113769293-113769315 GGACTGTGCAGGCCACAGCCCGG - Intronic
1113973364 13:114207676-114207698 GTTCCTAACAGGCCACAGACTGG + Intergenic
1114863776 14:26561203-26561225 GTTCTTAGCAGGCCACAGACCGG + Intronic
1115735269 14:36320797-36320819 GGTAATTGCAGACCACAGCTAGG + Intergenic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1117706496 14:58475139-58475161 GTTCCTAACAGGCCACAGACTGG - Intronic
1118142089 14:63095077-63095099 GCTCCTAACAGGCCACAGACTGG + Intronic
1119121606 14:72084355-72084377 GTTCCTAACAGGCCACAGACTGG + Intronic
1120861758 14:89261143-89261165 GGACATTGCAGGCCCCAGCCAGG - Intronic
1121584560 14:95054481-95054503 GGTCATCCCAGGCCAGGGCCTGG + Intergenic
1122268323 14:100557012-100557034 AGTCAGGGCAGGCCAAAGCCAGG + Intronic
1122865782 14:104603453-104603475 GGGCACAGCAGGCCTCAGCCAGG + Intronic
1124831477 15:33153712-33153734 GGTCATCGCAGTCGCCAGCCGGG - Exonic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1125249053 15:37678344-37678366 GTTCCTAACAGGCCACAGACTGG + Intergenic
1125375869 15:39028824-39028846 GTTCCTAACAGGCCACAGACCGG - Intergenic
1126010294 15:44296114-44296136 GATCATAGCACACCACAGCCAGG + Intronic
1126911512 15:53422007-53422029 GTTCCTAACAGGCCACAGACTGG - Intergenic
1127008562 15:54597236-54597258 GTTCCTAACAGGCCACAGACCGG + Intronic
1127320110 15:57835860-57835882 GTTCCTAGCAGGCCACAGATGGG + Intergenic
1127901055 15:63341294-63341316 GTTCCTAACAGGCCACAGACCGG - Intronic
1128159340 15:65413270-65413292 GGCCCTGGCAGCCCACAGCCTGG + Intronic
1128496404 15:68200921-68200943 GGGCAGAGCTGCCCACAGCCAGG - Intronic
1129332702 15:74835903-74835925 GGTCATTGCTGCCCACACCCAGG - Intergenic
1130954209 15:88615415-88615437 GGACCTACCAGGACACAGCCTGG - Intergenic
1132033359 15:98457536-98457558 GCTCCTAACAGGCCACAGACTGG + Intronic
1132331013 15:101012674-101012696 GGTCCTGCCAGGCCACTGCCAGG + Intronic
1132569703 16:638702-638724 GGAGATGGCAAGCCACAGCCAGG - Intronic
1133119986 16:3600304-3600326 GTTCCTAACAGGCCACAGACCGG + Intronic
1133660343 16:7910353-7910375 GTTCCTAACAGGCCACAGCTGGG + Intergenic
1134689244 16:16180218-16180240 GTTCCTAACAGGCCACAGACTGG + Intronic
1135063596 16:19290902-19290924 GGTCATAGCTTGCTGCAGCCTGG + Intronic
1136060940 16:27726011-27726033 GTTCCTAACAGGCCACAGACTGG - Intronic
1136277495 16:29187537-29187559 GGTCATAGCAGCCCTCAACAGGG + Intergenic
1137053783 16:35734088-35734110 GGTCATGGCGGGGCACAGGCAGG - Intergenic
1137404104 16:48176527-48176549 GGGCATTGCAGGGCACTGCCAGG - Intronic
1137817213 16:51409892-51409914 GGTCACAGCAGGCAACTGCCCGG + Intergenic
1138582724 16:57952118-57952140 GGGCATAGCAGGGGACATCCAGG + Intronic
1139305861 16:65985929-65985951 GTTCCTAACAGGCCACAGACTGG - Intergenic
1141043642 16:80694307-80694329 GTTCCTAACAGGCCACGGCCTGG + Intronic
1141216089 16:82025176-82025198 GTTCCTAACAGGCCACAGACTGG + Intergenic
1141441360 16:84031660-84031682 GGTCATCGCTAGCCACGGCCAGG + Intronic
1141698587 16:85632231-85632253 GCCCATGGCAGGCAACAGCCAGG - Intronic
1142081873 16:88153579-88153601 GGTCATAGCAGCCCTCAGCAGGG + Intergenic
1142959719 17:3545052-3545074 AGTGGTAGCATGCCACAGCCAGG + Intronic
1146513434 17:33470179-33470201 GGTAATAGCAGACTCCAGCCAGG + Intronic
1146738088 17:35256860-35256882 GTTCCTAACAGGCCACAGTCAGG - Intronic
1147976505 17:44251022-44251044 GGACACAGCAGGCCAGAACCTGG + Intronic
1148906807 17:50917484-50917506 GCCCACAGCAGGCCACAGCTGGG + Intergenic
1149440287 17:56668053-56668075 GTTCCTAACAGGCCACAGACTGG - Intergenic
1150517109 17:65825426-65825448 GTTCCTAACAGGCCACAGACAGG + Intronic
1151413409 17:73946133-73946155 GTTCCTAACAGGCCACAGACTGG - Intergenic
1151475153 17:74340998-74341020 AGTCATAGCTGGCCTTAGCCTGG + Intronic
1152163992 17:78689602-78689624 GCTCGTAACAGGCCACAGACTGG + Intronic
1152414518 17:80150607-80150629 GTTCCTAACAGGCCACAGACAGG - Intergenic
1152449590 17:80368841-80368863 GGACTCAGCAGGCCTCAGCCCGG + Intronic
1152805681 17:82354679-82354701 GGACAGAGCTGGCCACAGCCGGG + Intergenic
1152882050 17:82823223-82823245 GGTCAGGCCAGGCCACAGCCAGG - Intronic
1152945343 17:83194887-83194909 GTTCCTAACAGACCACAGCCTGG + Intergenic
1154414831 18:14171193-14171215 GGGTATGGCAGGGCACAGCCAGG + Intergenic
1155759638 18:29549619-29549641 GTTCCTAACAGGCCACAGACTGG - Intergenic
1155908328 18:31479022-31479044 GTTCCTAACAGGCCACAGACAGG + Intergenic
1158500991 18:58001702-58001724 GATCATAGCTGGCTGCAGCCAGG + Intergenic
1158595997 18:58816555-58816577 GTTCCTAACAGGCCACAGACCGG + Intergenic
1158909524 18:62046329-62046351 GTTCCTAACAGGCCACAGACTGG - Intronic
1159220149 18:65450514-65450536 GGTCATAACAGGACACAGAGTGG - Intergenic
1160279160 18:77471103-77471125 GGAAATAGCCGGCCACAGGCTGG - Intergenic
1160443837 18:78912535-78912557 GCTCAGAGCAGGACACAGCTTGG + Intergenic
1162037457 19:7949437-7949459 GTTCCTAACAGGCCACAGACAGG + Intergenic
1162388255 19:10373783-10373805 GGGCATAGCAGGCAAAAGCCAGG - Intronic
1162431166 19:10629641-10629663 GATCATAGCTCGCTACAGCCTGG + Intronic
1162450562 19:10751778-10751800 GGGCACAGGAGGGCACAGCCTGG - Intronic
1162684490 19:12370449-12370471 GCTCCTAACAGGCCACAGTCTGG + Intergenic
1163543513 19:17926502-17926524 GGTTATAGAGGCCCACAGCCTGG - Intergenic
1163611912 19:18306033-18306055 GTTCAGGGCAGGCCACATCCTGG + Intergenic
1163616835 19:18334152-18334174 GTTCCTAACAGGCCACAGACTGG - Intergenic
1164323729 19:24174165-24174187 GTTTATAACAGGCCACAGACTGG + Intergenic
1164611069 19:29632054-29632076 GGTCATTCCAGGCCACCACCAGG + Intergenic
1165930734 19:39356808-39356830 GGTAACAGGAGGCCAGAGCCGGG + Exonic
1166293572 19:41878285-41878307 GGCCAGGGCAGGCCACAGACTGG + Intronic
1168384640 19:55953000-55953022 GTTCCTAACAGGCCACAGACTGG - Intronic
1168568722 19:57446132-57446154 GTTCCTAACAGGCCACAGACTGG - Intronic
925029588 2:639183-639205 GTTCCTAACAGGCCACAGGCTGG + Intergenic
925103829 2:1272434-1272456 GTTCCTAACAGGCCACAGACTGG + Intronic
926167355 2:10529813-10529835 GGTCATGGGAGGCCCCAGCGGGG + Intergenic
927138973 2:20117209-20117231 GGCCATAGGAGGGCACAGCGAGG + Intergenic
927507863 2:23626353-23626375 GTTCCTAACAGGCCACAGGCTGG + Intronic
927857691 2:26537597-26537619 GCTCAGAGCAGGCCAGTGCCTGG + Intronic
928711990 2:34017655-34017677 GTTCCTAACAGGCCACAGACTGG + Intergenic
930948390 2:57105837-57105859 GTTCCTAGCAGGCCACAGACAGG - Intergenic
934876097 2:97922296-97922318 GTTCCTAACAGGCCACAGACCGG + Intronic
936034506 2:109100201-109100223 GTTCCTAACAGGCCACAGACTGG - Intergenic
936055445 2:109258807-109258829 GGTCAGAGCAGGACCCATCCAGG + Intronic
936755943 2:115712413-115712435 GTTCTTAACAGGCCACAGACTGG + Intronic
937246914 2:120499537-120499559 GGAAATTGCAGGCCACAGTCAGG - Intergenic
937326212 2:120990711-120990733 GGTCATCGCTGCCCAGAGCCTGG + Exonic
937988524 2:127649552-127649574 GGCCAGAGCAGCCCGCAGCCCGG - Intronic
938384076 2:130852361-130852383 GGTGATAGCAGACCACAGTGTGG + Intronic
940293786 2:152101683-152101705 GTTCCTAACAGGCCACAGACTGG - Intergenic
940297194 2:152139488-152139510 GAGCATAGCACGCTACAGCCTGG - Intronic
944311606 2:198239912-198239934 GTTCCTAACAGGCCACAGACTGG - Intronic
944896195 2:204167782-204167804 GTTCCTAACAGGCCACAGACTGG - Intergenic
945027310 2:205631416-205631438 GTTCCTAACAGGCCACAGACCGG + Intergenic
945526592 2:210895383-210895405 GTTCCTAACAGGCCACAGACTGG + Intergenic
946779309 2:223176567-223176589 GTTCCTAACAGGCCACAGACCGG - Intronic
946806397 2:223475016-223475038 GTTCTTAGCAGGCCACAGACTGG - Intergenic
947218727 2:227772514-227772536 GTTCCCAGCAGGCCACAGACTGG - Intergenic
948165358 2:235857107-235857129 GTTCCTAACAGGCCACAGACTGG - Intronic
948330189 2:237158423-237158445 GTTCCTAACAGGCCACAGACTGG + Intergenic
948386076 2:237581945-237581967 TGTCCTAACAGGCCACAGCAGGG - Intronic
948516337 2:238506066-238506088 GTTCCTAACAGGCCACAGTCGGG + Intergenic
948535741 2:238645243-238645265 GTTCCTAACAGGCCACAGACAGG - Intergenic
948654740 2:239469619-239469641 GTTCCTAACAGGCCACAGACTGG + Intergenic
1169322014 20:4640763-4640785 GTTCCTAACAGGCCACAGACTGG - Intergenic
1169407199 20:5331749-5331771 GTTCATAACAGACCACAGACTGG + Intergenic
1169946675 20:10996489-10996511 GTTCCTAACAGGCCACAGACTGG - Intergenic
1170135538 20:13069645-13069667 GTTCCTAACAGGCCACAGACTGG + Intronic
1172622004 20:36323931-36323953 GTTCCTAACAGGCCACAGACTGG + Intronic
1172633651 20:36394864-36394886 GGCCCTAGCATGCCACTGCCTGG + Intronic
1174897805 20:54469372-54469394 GGTCCTTGCAGGCCACAGCAAGG - Intergenic
1175016919 20:55801688-55801710 GCTCCTTGCAGGCCACTGCCTGG + Intergenic
1175805866 20:61829104-61829126 GTTCCTAACAGGCCACAGACCGG + Intronic
1176858193 21:13987078-13987100 GGGTATGGCAGGGCACAGCCAGG - Intergenic
1177417161 21:20808760-20808782 GTTCCTAACAGGCCACAGACCGG - Intergenic
1178325298 21:31640946-31640968 GTTCCTAGCAGTCCACAGACTGG + Intergenic
1178380605 21:32104438-32104460 GTTCATAACAGGCCACGGACAGG - Intergenic
1179243349 21:39610564-39610586 GGACAGAGCAGACCACTGCCTGG + Intronic
1180041777 21:45283841-45283863 GGTCCTGGCAGGGAACAGCCTGG - Intronic
1180100778 21:45584005-45584027 GTTCCTAACAGGCCACAGACTGG + Intergenic
1181567343 22:23747210-23747232 GTTCCTAACAGGCCACAGACTGG - Intronic
1182722574 22:32415267-32415289 GTTCCTAACAGGCCACAGACCGG + Intronic
1183060811 22:35335364-35335386 GGACCTAGCAGGCTACAGCCTGG - Intronic
1183701311 22:39452766-39452788 GGGCACAGCCGGGCACAGCCAGG - Intergenic
1183982375 22:41549142-41549164 CGTCATGGCGGGGCACAGCCTGG - Intergenic
1184245878 22:43235510-43235532 GGGCCAGGCAGGCCACAGCCAGG - Intronic
1184693649 22:46128404-46128426 GGTCACAGGGGGCCACGGCCAGG - Intergenic
949293665 3:2495524-2495546 GTTCCTAACAGGCCACAGACAGG - Intronic
949771581 3:7585244-7585266 GGTCACAGCAGGCAACAGAAAGG - Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
950992857 3:17459461-17459483 GTTCCTAACAGGCCACAGCCTGG + Intronic
951628149 3:24689472-24689494 GTTCCTAACAGGCCACAGACTGG - Intergenic
952114170 3:30159471-30159493 GGTGATAACAGGCCACAACAAGG - Intergenic
955623901 3:60895960-60895982 GTTCCTAACAGGCCACAGACTGG - Intronic
956213831 3:66827921-66827943 GTTCCTAACAGGCCACAGACCGG + Intergenic
957623349 3:82624173-82624195 GTTCATAACAGGCCACAGACTGG - Intergenic
959033663 3:101334133-101334155 GCTCCTAACAGGCCACAGACTGG + Intronic
960766448 3:121135745-121135767 GTTCCTAACAGGCCACAGACTGG + Intronic
960891089 3:122448904-122448926 GATTATAGCAGGCTACAGACTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961253024 3:125522499-125522521 GTTCCTAGCAGACCACAGACTGG + Intergenic
962053215 3:131841398-131841420 GTTCCTAACAGGCCACAGACTGG - Intronic
962197620 3:133377735-133377757 GTTCCTAACAGGCCACAGACTGG - Intronic
963536789 3:146539410-146539432 GTTCCTAACAGGCCACAGACTGG + Intronic
965639274 3:170815520-170815542 GTTCCTAACAGGCCACAGACTGG - Intronic
966358481 3:179107865-179107887 GTTCTTAACAGGCCACAGACTGG + Intergenic
966494657 3:180566222-180566244 GGTCAGGGCAGGACACAGCAAGG + Intergenic
967009868 3:185422803-185422825 GTTCCTAACAGGCCACAGACTGG - Intronic
968331485 3:197874173-197874195 GTTCCTAACAGGCCACAGACTGG - Intronic
968641718 4:1718097-1718119 GCACATGGCAGGCCAGAGCCAGG - Intronic
968872352 4:3248368-3248390 GGGCATGGCAGGGCACAGTCTGG - Exonic
969507797 4:7598923-7598945 GGGCCTTGCTGGCCACAGCCTGG + Intronic
970170021 4:13280171-13280193 GTTCCTAACAGGCCACAGACTGG - Intergenic
970388896 4:15587315-15587337 GTTCCTAACAGGCCACAGACTGG + Intronic
970620829 4:17816369-17816391 GTTCCTAACAGGCCACAGACTGG + Intronic
971212936 4:24637242-24637264 GCTCCTAACAGGCCACAGCCAGG - Intergenic
971564556 4:28120754-28120776 GCTCCTAACAGGCCACAGACTGG + Intergenic
972027654 4:34405536-34405558 GATCCTAGCAGGCCACAGGCTGG + Intergenic
972622569 4:40762668-40762690 GTTCCTAACAGGCCACAGACAGG - Intronic
972663389 4:41140605-41140627 GTTCCTAACAGGCCACAGACTGG - Intronic
973855646 4:55007921-55007943 GGTAATAGGAGGACACAGCCAGG + Intergenic
974508361 4:62806696-62806718 GGGCATAGCTGGGCACAGCTTGG + Intergenic
977699853 4:100008758-100008780 GTTCCTAGCAGGCCATAGACTGG + Intergenic
978407883 4:108399016-108399038 TGTCATCCCAAGCCACAGCCAGG + Intergenic
978623192 4:110655111-110655133 GTTCCTAACAGGCCACAGACTGG + Intergenic
979489510 4:121309019-121309041 GTTCCTAACAGGCCACAGACAGG - Intergenic
980132754 4:128831920-128831942 GGTCAGAGAAAGCCAAAGCCTGG + Intronic
981591311 4:146365853-146365875 GTTCCTAACAGGCCACAGACTGG - Intronic
982146833 4:152403792-152403814 GTTCCTAACAGGCCACAGACTGG + Intronic
984385295 4:179048035-179048057 GTTCCTAACAGGCCACAGACTGG + Intergenic
984772943 4:183454120-183454142 GTTCCTAACAGGCCACAGACTGG + Intergenic
985371152 4:189285816-189285838 GGCTATAGCAGGCAACAGCAGGG + Intergenic
985779721 5:1864017-1864039 AGTAATAACTGGCCACAGCCGGG - Intergenic
986025732 5:3849000-3849022 GGTGATATCAGGACACAGCGTGG - Intergenic
986281075 5:6323036-6323058 GGTTCTAGCAGGACCCAGCCTGG - Intergenic
987018829 5:13848875-13848897 GTTCCTAACAGGCCACAGACTGG + Intronic
987139715 5:14932520-14932542 GGTCATAGCACACTGCAGCCTGG - Intergenic
987184939 5:15407696-15407718 GTTCCTAACAGGCCACAGACCGG + Intergenic
988813622 5:34808994-34809016 GATCCTAACAGGCCACAGACTGG + Intronic
990009643 5:50981591-50981613 GTTCCTAACAGGCCATAGCCAGG - Intergenic
990397219 5:55394660-55394682 GTTCTTAACAGGCCACAGACTGG + Intronic
990522696 5:56595149-56595171 TGTTATAACAAGCCACAGCCAGG + Intronic
991622476 5:68559205-68559227 GTTCGTAACAGGCCACAGACTGG - Intergenic
992339304 5:75805906-75805928 GGTCATTTCAGTCCACTGCCTGG - Intergenic
992563189 5:77972717-77972739 GCCCAGAGCAGGCCGCAGCCTGG + Intergenic
992613520 5:78528268-78528290 GTTCCTAACAGGCCACAGACCGG - Intronic
993157556 5:84244790-84244812 GTTCATAACAGGCCACGGACTGG - Intronic
993384841 5:87251795-87251817 GGCCAGGGCAGGCCTCAGCCTGG - Intergenic
995627816 5:114098367-114098389 GTTCCTAACAGGCCACAGACTGG - Intergenic
996228366 5:121030403-121030425 GTTCCTAACAGGCCACAGACTGG + Intergenic
997669877 5:135662085-135662107 GTTCATAGCTTGCCACAGCAGGG - Intergenic
997693850 5:135845994-135846016 GTTCCTAACAGGCCACAGGCTGG - Intronic
997924330 5:138014320-138014342 GTTCCTAACAGGCCACAGACTGG - Intronic
1000338977 5:160262417-160262439 GCACACGGCAGGCCACAGCCAGG + Intronic
1004795629 6:19080167-19080189 GTTCCTAACAGGCCACAGACCGG - Intergenic
1005086784 6:22015161-22015183 GTTCCTAACAGGCCACAGACTGG - Intergenic
1005387973 6:25304651-25304673 GTTCCTAACAGGCCACAGACTGG + Intronic
1006720169 6:36145076-36145098 GTTCCTAACAGGCCACAGACAGG + Intergenic
1006930438 6:37684673-37684695 GGTCATTGAAGGCCACTGGCTGG + Intronic
1006931728 6:37692761-37692783 GGTCCCAGCAGCTCACAGCCAGG + Intronic
1007152647 6:39709515-39709537 GTTCCTAACAGGCCACAGACTGG + Intronic
1008130235 6:47712939-47712961 GATCCTAAGAGGCCACAGCCCGG - Intronic
1008523813 6:52387727-52387749 GTTCCTAACAGGCCACAGACAGG - Intronic
1008596188 6:53044161-53044183 GCTCCTAACAGGCCACAGACTGG - Intronic
1008950834 6:57156993-57157015 GTTCTTAACAGGCCACAGACTGG + Intronic
1009513418 6:64582207-64582229 GTTCCTAACAGGCCACAGACAGG - Intronic
1011637646 6:89389078-89389100 GTTCCTAACAGGCCACAGACTGG + Intronic
1012211995 6:96530927-96530949 GTTCCTAACAGGCCACAGACTGG - Intronic
1013014559 6:106149638-106149660 GGTCACATCAGACCACATCCAGG + Intergenic
1014460446 6:121688322-121688344 GTTCCTAACAGGCCACAGACAGG + Intergenic
1014895900 6:126898658-126898680 GTTCCTAACAGGCCACAGACTGG + Intergenic
1015066805 6:129039889-129039911 GTTCCTAACAGGCCACAGGCTGG + Intronic
1015305044 6:131697798-131697820 GTTCCTAACAGGCCACAGACAGG + Intronic
1015370149 6:132441219-132441241 GGTCATAGCGGCCTACAGGCAGG - Intergenic
1015953730 6:138579194-138579216 GTTCCTAATAGGCCACAGCCTGG + Intronic
1015985663 6:138881875-138881897 GTTCCTAACAGGCCACAGACTGG + Intronic
1016757012 6:147698185-147698207 GTTCCTAACAGGCCACAGACCGG + Intronic
1016945729 6:149530899-149530921 GGTCATGGTAGTCCACTGCCTGG - Intronic
1017490127 6:154937727-154937749 AGTCACAGCGGGCCATAGCCAGG - Intronic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1018489301 6:164275414-164275436 GTTCCTAACAGGCCACAGACTGG - Intergenic
1018786819 6:167114626-167114648 CGTCACAGCAGGCCTCGGCCAGG - Intergenic
1018945431 6:168344604-168344626 GGGCCTAGCACCCCACAGCCAGG - Intergenic
1021749979 7:23787448-23787470 GTTCTTAACAGGCCACAGACTGG - Intronic
1022935310 7:35169478-35169500 AGTCATGGCAAGCCACAGCTAGG - Intergenic
1023327030 7:39071420-39071442 GTTCCTAACAGGCCACAGACTGG + Intronic
1023383922 7:39635849-39635871 GTTCCTAACAGGCCACAGACTGG + Intronic
1023591005 7:41780509-41780531 GTTCCTAACAGGCCACAGACTGG - Intergenic
1024690424 7:51795490-51795512 GTTCCTAACAGGCCACAGACAGG + Intergenic
1025211404 7:57021091-57021113 GCTCACAGCAGGCCCCACCCAGG - Intergenic
1025625607 7:63218617-63218639 GTTCCTAACAGGCCATAGCCTGG + Intergenic
1026313781 7:69210866-69210888 GTTCCTAACAGGCCACAGACTGG - Intergenic
1026620446 7:71945480-71945502 GTTCCTAACAGGCCACAGACTGG - Intronic
1029034396 7:97503588-97503610 GTTCTTAACAGGCCACAGACCGG - Intergenic
1029335192 7:99892890-99892912 AGGCCTAGCAGGCCACAGCATGG + Intronic
1029422943 7:100480711-100480733 GATCATAGCTCACCACAGCCTGG + Intergenic
1029431793 7:100535999-100536021 GTTCCTAACAGGCCACAGACAGG + Intergenic
1029831264 7:103262254-103262276 AGTCATGGCAAGCCACAGCTAGG - Intergenic
1033479826 7:141728705-141728727 GTTCCTAACAGGCCACAGACTGG - Intronic
1034046178 7:147930048-147930070 GTTCCTAACAGGCCACAGACTGG + Intronic
1035015061 7:155758582-155758604 GTTCCTAACAGGCCACAGACTGG + Intronic
1035286092 7:157808137-157808159 GTTCCTAACAGGCCACAGACTGG - Intronic
1035744024 8:1948492-1948514 GGTGGCAGCAGACCACAGCCTGG - Intronic
1036119849 8:6004137-6004159 GTTCCTAGCAGGCCACGGACTGG - Intergenic
1036586300 8:10126979-10127001 GTTCCCAACAGGCCACAGCCTGG + Intronic
1037690392 8:21176907-21176929 GTTCCTAACAGGCCACAGACTGG + Intergenic
1038191088 8:25321731-25321753 GTTCCTAACAGGCCACAGACTGG + Intronic
1038422843 8:27444457-27444479 GGTCTTAGCTGAGCACAGCCTGG - Intronic
1038706586 8:29899570-29899592 GTTCCTAACAGGCCACAGACTGG - Intergenic
1040031094 8:42824428-42824450 GTTCCTAACAGGCCACAGACTGG + Intergenic
1040551890 8:48444192-48444214 GGTCATGGGAGGCCTCAGCTCGG + Intergenic
1041051452 8:53938915-53938937 GGTCCGGGCAGGCCACAGTCTGG + Intronic
1041928266 8:63260278-63260300 GTTCCTAACAGGCCACAGACTGG - Intergenic
1043544698 8:81302180-81302202 GTTCCTAACAGGCCACTGCCGGG - Intergenic
1044136711 8:88594761-88594783 GTTCCTAACAGGCCACAGACTGG + Intergenic
1044586791 8:93875895-93875917 GTTCATAACAGGCCACAGGCTGG + Intronic
1044714145 8:95085430-95085452 GGTCATAGAAAACCTCAGCCAGG + Intronic
1046534950 8:115497417-115497439 GTTCCTAACAGGCCACAGACTGG + Intronic
1048044823 8:130763734-130763756 GTTCCTAACAGGCCACAGACAGG + Intergenic
1048583415 8:135749934-135749956 GTTCTTAACAGGCCACAGACAGG - Intergenic
1048733483 8:137470986-137471008 GGACATTGCAGGCCAAGGCCAGG + Intergenic
1049156972 8:141073245-141073267 AGTCAGAGCAGGCCTCATCCTGG + Intergenic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049626056 8:143621990-143622012 GTTCCTAACAGGCCACAGACCGG + Intergenic
1051545225 9:18266320-18266342 AGTCACAGCAGACCAGAGCCTGG + Intergenic
1051689571 9:19695989-19696011 GTTCTTAACAGGCCACAGACTGG - Intronic
1052986294 9:34490562-34490584 GGCCCTAGCAGACCTCAGCCTGG + Intronic
1053055044 9:34989058-34989080 GGTCACATCAGGCCACCGCGGGG + Intergenic
1054809768 9:69425539-69425561 GTTCCTAACAGGCCACAGACTGG - Intergenic
1055909324 9:81329314-81329336 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056144088 9:83712017-83712039 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056189175 9:84167828-84167850 GTTCCTAACAGGCCACAGACTGG - Intergenic
1056885055 9:90433752-90433774 GTTCCTAACAGGCCACAGACAGG - Intergenic
1057007164 9:91570380-91570402 GTTCCTAACAGGCCACAGACTGG + Intronic
1057090905 9:92257424-92257446 GGTCAAAGCTCCCCACAGCCAGG - Intronic
1057276407 9:93678063-93678085 AGTCAGAGCTGGCCACAGGCTGG + Exonic
1057645519 9:96871357-96871379 AGTCATAGCATACCACAGCCTGG + Intronic
1057890711 9:98867732-98867754 GGGCAGGGGAGGCCACAGCCTGG + Intergenic
1058914968 9:109556905-109556927 GGTCATTGCAGCCTGCAGCCTGG + Intergenic
1058918571 9:109591166-109591188 GGTCATAGGACTCCACCGCCAGG - Intergenic
1059151734 9:111955290-111955312 GCTCCTAACAGGCCACAGACGGG + Intergenic
1059164346 9:112064205-112064227 GTTCCTAACAGGCCACAGACTGG - Intronic
1059341647 9:113600846-113600868 GGTCATAGCTGGCCCAAGACAGG - Intergenic
1059347999 9:113645343-113645365 GCTCCTAACAGGCCACAGACTGG - Intergenic
1059795734 9:117694451-117694473 GTTCCTAACAGGCCACAGACTGG - Intergenic
1062039320 9:134396836-134396858 GGTCTGAGCAGGCCACAGGCTGG - Intronic
1062265994 9:135686763-135686785 GGCCAAGGCAGGCCACAGACAGG - Intergenic
1062401409 9:136374310-136374332 GGTGACAGCAGGGCACAGCTCGG + Intergenic
1185742375 X:2544139-2544161 GTTCCTAACAGGCCACAGACTGG - Intergenic
1185788263 X:2908820-2908842 GGTGATTGATGGCCACAGCCTGG - Exonic
1185981513 X:4785120-4785142 GTTCCTAACAGGCCACAGACCGG - Intergenic
1186640384 X:11449242-11449264 GGGGATGGCAGGCCAAAGCCAGG - Intronic
1188065935 X:25659290-25659312 GTTCCTAACAGGCCACAGACTGG + Intergenic
1188232865 X:27687042-27687064 GTTCCTAACAGGCCACAGACAGG + Intronic
1188469216 X:30518351-30518373 GTTCTTAAGAGGCCACAGCCTGG + Intergenic
1189291285 X:39887711-39887733 GGGAATAGGAGGCCAAAGCCTGG + Intergenic
1189483881 X:41414260-41414282 GCTCCTAACAGGCCACAGACTGG - Intergenic
1189492631 X:41481885-41481907 GGACAAAGCGGGCCACTGCCTGG - Intergenic
1190027191 X:46935440-46935462 GTTCCTAACAGGCCACAGACTGG - Intronic
1190402182 X:50048320-50048342 GTTCCTAACAGGCCACAGACTGG + Intronic
1192102263 X:68277370-68277392 GCTCCTAACAGGCCACAGACTGG + Intronic
1192496690 X:71620950-71620972 GTTCCTAACAGGCCACAGACCGG + Intergenic
1195256997 X:103100840-103100862 GGTGATAGTACGCTACAGCCTGG - Intergenic
1195423330 X:104699579-104699601 GGTCCTAACAGGCCACTGACTGG + Intronic
1195465779 X:105177064-105177086 GTTCCTAGCAGGACACAGACTGG - Intronic
1195768833 X:108327079-108327101 GTTCCTAACAGGCCACAGACAGG - Intronic
1195922379 X:109996399-109996421 GTTCCTAACAGGCCACAGACTGG + Intergenic
1197758004 X:130009798-130009820 GGTCATAGCAGGCTTCAGTCAGG - Intronic
1197982142 X:132228283-132228305 GTTCCTAACAGGCCACAGACCGG - Intergenic
1198617680 X:138477545-138477567 GTTCCTAACAGGCCACAGACTGG + Intergenic
1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG + Intergenic
1199213759 X:145244167-145244189 GCTCACAGGAAGCCACAGCCAGG - Intergenic
1200368507 X:155694929-155694951 GTTCCTAACAGGCCACAGACTGG + Intergenic
1201589816 Y:15602820-15602842 GTTCCTAACAGGCCACAGACTGG - Intergenic