ID: 1049592621

View in Genome Browser
Species Human (GRCh38)
Location 8:143469447-143469469
Sequence CTGAAGCCCTGGGCTGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049592604_1049592621 25 Left 1049592604 8:143469399-143469421 CCAGCTGCCCACTGCAGCTGTGG 0: 1
1: 0
2: 4
3: 41
4: 384
Right 1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG No data
1049592607_1049592621 18 Left 1049592607 8:143469406-143469428 CCCACTGCAGCTGTGGAGGTCTG 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG No data
1049592608_1049592621 17 Left 1049592608 8:143469407-143469429 CCACTGCAGCTGTGGAGGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 262
Right 1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG No data
1049592603_1049592621 26 Left 1049592603 8:143469398-143469420 CCCAGCTGCCCACTGCAGCTGTG 0: 1
1: 0
2: 12
3: 41
4: 346
Right 1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049592621 Original CRISPR CTGAAGCCCTGGGCTGGCGC TGG Intronic
No off target data available for this crispr