ID: 1049593436

View in Genome Browser
Species Human (GRCh38)
Location 8:143472784-143472806
Sequence GTCCCGCGGGTGCACGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049593424_1049593436 1 Left 1049593424 8:143472760-143472782 CCCATGCCACAAGCCCCTCCGTG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593421_1049593436 21 Left 1049593421 8:143472740-143472762 CCCCGGTGCGGGGAGACGGACCC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593425_1049593436 0 Left 1049593425 8:143472761-143472783 CCATGCCACAAGCCCCTCCGTGG 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593423_1049593436 19 Left 1049593423 8:143472742-143472764 CCGGTGCGGGGAGACGGACCCAT 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593428_1049593436 -5 Left 1049593428 8:143472766-143472788 CCACAAGCCCCTCCGTGGGTCCC 0: 1
1: 0
2: 4
3: 33
4: 304
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593418_1049593436 29 Left 1049593418 8:143472732-143472754 CCCAAGGGCCCCGGTGCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593422_1049593436 20 Left 1049593422 8:143472741-143472763 CCCGGTGCGGGGAGACGGACCCA 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data
1049593419_1049593436 28 Left 1049593419 8:143472733-143472755 CCAAGGGCCCCGGTGCGGGGAGA 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049593436 Original CRISPR GTCCCGCGGGTGCACGGTGC AGG Intronic
No off target data available for this crispr