ID: 1049595065

View in Genome Browser
Species Human (GRCh38)
Location 8:143479553-143479575
Sequence TGGATAATGAAGGCCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049595055_1049595065 30 Left 1049595055 8:143479500-143479522 CCACGCTGCCAGGAAATTTCATT 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG No data
1049595056_1049595065 22 Left 1049595056 8:143479508-143479530 CCAGGAAATTTCATTAACGCTGG 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049595065 Original CRISPR TGGATAATGAAGGCCAGGGA GGG Intronic
No off target data available for this crispr