ID: 1049599273

View in Genome Browser
Species Human (GRCh38)
Location 8:143499457-143499479
Sequence ACTGAACACCGGCTGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049599273_1049599278 -9 Left 1049599273 8:143499457-143499479 CCTGCGCCCAGCCGGTGTTCAGT 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1049599278 8:143499471-143499493 GTGTTCAGTGCAAACACAGTGGG No data
1049599273_1049599277 -10 Left 1049599273 8:143499457-143499479 CCTGCGCCCAGCCGGTGTTCAGT 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1049599277 8:143499470-143499492 GGTGTTCAGTGCAAACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049599273 Original CRISPR ACTGAACACCGGCTGGGCGC AGG (reversed) Intronic
900003513 1:29177-29199 GCGGAACACCAGCTTGGCGCAGG + Intergenic
900023233 1:199693-199715 GCGGAACACCAGCTTGGCGCAGG + Intergenic
900099197 1:953881-953903 ACAGGACACCAGCTGGGGGCAGG + Exonic
900653896 1:3745556-3745578 ACTGAACACCTGCTGTGTGCCGG - Intergenic
902243974 1:15107182-15107204 ATTGAACACCTGCTGTGAGCAGG + Intronic
904018718 1:27444436-27444458 ACTGAATACCTACTGGGTGCTGG - Intronic
904265072 1:29313564-29313586 ACAGAACATTGGCTGGGCACAGG + Intronic
904279838 1:29411179-29411201 ACTGCACACCTGCTGCACGCTGG + Intergenic
905653711 1:39672636-39672658 ACTGAGCTCCCGCTGGGAGCAGG - Intergenic
906670577 1:47651350-47651372 CCTGAACACCTGCTGAGTGCTGG - Intergenic
910805964 1:91190182-91190204 CCTGACCACCAGCTGGGCACTGG - Intergenic
912625269 1:111200906-111200928 ACTGGAAACCGGCTGGTCTCAGG + Exonic
913046005 1:115073989-115074011 ACTGGACACCTTCTGGGCCCAGG + Intronic
913497644 1:119443126-119443148 ATTGAACACCTGCTGTGCTCTGG + Intergenic
913505342 1:119511751-119511773 ACTGAACACCTGCTGTGCTCTGG + Intronic
913508712 1:119543043-119543065 ACTGAACACCTGCTGTACTCTGG + Intergenic
913511661 1:119568137-119568159 ACTGAACACCTGCTATGCTCTGG + Intergenic
913515891 1:119605462-119605484 ACTGAACACCTGCTATGCTCTGG + Intergenic
913592493 1:120342152-120342174 AGCGATCACCGGCTGGGCGGCGG + Intergenic
913650857 1:120912978-120913000 AGCGATCACCGGCTGGGCGGCGG - Intergenic
914223465 1:145700913-145700935 ACTTAGCAGGGGCTGGGCGCGGG + Intronic
914525373 1:148460055-148460077 AGCGATCACCGGCTGGGCGGCGG + Intergenic
914598301 1:149175775-149175797 AGCGATCACCGGCTGGGCGGCGG - Intergenic
914641028 1:149607073-149607095 AGCGATCACCGGCTGGGCGGCGG - Intergenic
915361171 1:155287195-155287217 CCCGAACACTGGCTGTGCGCCGG - Exonic
916054051 1:161055498-161055520 ACAAAAAACAGGCTGGGCGCAGG + Intronic
919923971 1:202182783-202182805 ACTGAGCACTGGCTGTGCACAGG + Intergenic
1063422267 10:5922761-5922783 GCTGAGCACTGGCTGGGCTCCGG - Intronic
1065115482 10:22478907-22478929 ACTGAATAGCTGCTGGGTGCAGG - Intergenic
1065742597 10:28810824-28810846 ACTGAACCTAGGCTGGGGGCAGG + Intergenic
1067682647 10:48450481-48450503 CCTGCACACCGACTGGGCCCTGG - Exonic
1067734790 10:48841819-48841841 ACTGCACACCTGCTGGGAACAGG + Intronic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1072806665 10:98427707-98427729 ACTGAGCACCTGCTGTGTGCTGG + Intronic
1073076846 10:100829683-100829705 ACTGGAGCCTGGCTGGGCGCCGG - Exonic
1076765174 10:132629374-132629396 ACTGAACAGCTGCAGGGCCCTGG - Intronic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1083332970 11:61907545-61907567 GAGGTACACCGGCTGGGCGCGGG - Exonic
1083971491 11:66079172-66079194 ACTGAAAAGAGGCTGGGCGGTGG - Intronic
1084003798 11:66313001-66313023 GCTGAGCCCGGGCTGGGCGCAGG + Intergenic
1084648431 11:70474159-70474181 ACTGTCCACTGGGTGGGCGCTGG - Intronic
1088785735 11:113180180-113180202 ATTGAACAGCTGCTGGGCACAGG + Intronic
1089300275 11:117494558-117494580 ACAGATCACCGGCTGGGCATGGG + Intronic
1091093484 11:132794317-132794339 ACTGAACATCTGCAGGGCGCAGG + Intronic
1091376932 12:31231-31253 GCGGAACACCAGCTTGGCGCAGG + Intergenic
1091607067 12:1962320-1962342 TCTGAACACTGGCTGGTCACAGG + Intronic
1092523856 12:9297701-9297723 ACTGAGCATCTGCTGAGCGCTGG - Intergenic
1092543442 12:9434198-9434220 ACTGAGCATCTGCTGAGCGCTGG + Intergenic
1094509504 12:31087858-31087880 ACTGAGCATCTGCTGAGCGCTGG - Intronic
1095742514 12:45622717-45622739 ACTGAACACTGTCTGTGCCCTGG - Intergenic
1097132883 12:56826332-56826354 ACTGTACTCCAGCTGGGCGAAGG - Intergenic
1108503197 13:51086267-51086289 ACTGCACACAGCCTGGGCGATGG + Intergenic
1109284691 13:60397090-60397112 ACCAAACACCGGCTGGTGGCTGG - Intronic
1113944138 13:114034131-114034153 CCTGAACACCAGCCGGGCACTGG + Intronic
1118451417 14:65905970-65905992 ACTGAGTCCTGGCTGGGCGCGGG + Intergenic
1122108819 14:99480976-99480998 ACGGAACGCCGGCTGGGTGGCGG - Intergenic
1125536909 15:40446321-40446343 ACTGAACACCGGCCCAGCCCTGG + Intronic
1125788449 15:42343702-42343724 ACTGAACCCAGGCAGGGCACAGG + Intronic
1129655040 15:77518456-77518478 ACTGTACACAGGCTGGTCCCTGG + Intergenic
1131438038 15:92438560-92438582 GCTGAACAGCGGCTGTGGGCAGG + Exonic
1131476488 15:92744479-92744501 TGCGACCACCGGCTGGGCGCTGG - Intronic
1132449988 15:101961763-101961785 GCGGAACACCAGCTTGGCGCAGG - Intergenic
1133008412 16:2897203-2897225 ACTGAACAGCAGCTGTGTGCAGG + Intronic
1133171161 16:3983276-3983298 ACTGAAGACCGCCAGGGCGGCGG + Exonic
1135049316 16:19179689-19179711 GCTGAACCCTGGCTGGGTGCTGG - Intronic
1136061575 16:27730182-27730204 GCTGAACACAGGCTGTGCACTGG + Intronic
1136471381 16:30483072-30483094 ACTGAACACCAGATGGGCCAAGG - Intronic
1139636548 16:68261653-68261675 ACTGGGTACCGGCTGGGCTCTGG - Intergenic
1140113950 16:72025815-72025837 ACTGAACACTGACTGTGGGCTGG + Intronic
1140784150 16:78323933-78323955 ACTGAGCAGCAGCTGGGTGCTGG + Intronic
1141115781 16:81307885-81307907 ACTGAACACCTGCTACGGGCCGG + Intergenic
1142272478 16:89097499-89097521 ACAGAAAACCGACTGGGCACTGG - Intronic
1142350076 16:89575765-89575787 CCTGAACGCCTGCCGGGCGCGGG - Exonic
1147566018 17:41536887-41536909 ACTGAACACCCGCTGTATGCTGG + Intergenic
1147623707 17:41885594-41885616 ACTGAGCACCTGCTGAACGCAGG + Intronic
1149348372 17:55762151-55762173 CCTGAAAACAGGCTGGGCTCAGG - Intronic
1150048807 17:61938759-61938781 ACTGCACTCCGCCTGGGCGATGG - Intergenic
1151566263 17:74900248-74900270 ACTGAGCACCGGCTGGGTACAGG - Intergenic
1152189419 17:78879467-78879489 ACTGAACACCTACTGGGTGCTGG + Intronic
1158470573 18:57732842-57732864 ATTCAACTCCGGCCGGGCGCGGG - Intronic
1160101611 18:75924587-75924609 ACTGAAAGCCGGCTGGGGTCAGG + Intergenic
1160479632 18:79226897-79226919 ACTGAACACCTGCTGTGTGTTGG + Intronic
1160479644 18:79226983-79227005 ACTGAACACCTGCTGTGTGTCGG + Intronic
1160635266 19:70785-70807 GCGGAACACCAGCTTGGCGCAGG + Intergenic
1161983140 19:7640900-7640922 ACTGAACAGGGGCTCGGGGCAGG - Exonic
1162683785 19:12365389-12365411 ACTGAAGGCCGGCTGGGCCAGGG + Intronic
1163485354 19:17582330-17582352 ACTGAGCACCTGCTGTGTGCAGG + Exonic
1163680760 19:18680954-18680976 ACAAAAAACAGGCTGGGCGCTGG - Intergenic
1165421742 19:35725468-35725490 ACAGAACACCAGCTGGGGACAGG - Exonic
1165445901 19:35856670-35856692 CCTCAACCCCGGCAGGGCGCAGG + Intronic
1166502898 19:43354272-43354294 ACTGAGCACCGGATGGGCCCCGG + Exonic
1167710548 19:51107955-51107977 ACTGAGCACCGACTCTGCGCAGG - Intronic
1167974567 19:53214370-53214392 ACTTAGCATGGGCTGGGCGCAGG - Intergenic
926134698 2:10328313-10328335 ACTGAACACCTGCTCTGTGCTGG - Intronic
927682215 2:25147119-25147141 ACTGAACAGGGGCCGGGCGCTGG - Intronic
928094076 2:28393383-28393405 GCTGAGCTCCGGCTGCGCGCGGG + Exonic
935587309 2:104813180-104813202 ACTGATCACCAGCTGGGGTCAGG + Intergenic
936566214 2:113584258-113584280 GCGGAACACCAGCTTGGCGCAGG - Intergenic
937960731 2:127456012-127456034 ACTGGACACCTGCTGTGAGCAGG + Intronic
938226336 2:129619610-129619632 AATGAACACCTGCTGGTCACTGG + Intergenic
940642846 2:156365173-156365195 AGTGAACAACAGCTGGGCTCTGG + Intergenic
942090911 2:172489984-172490006 AGTGAACACTGGCTGGCCCCTGG - Intronic
943789295 2:191913822-191913844 ACTGATCACCAGCTGGGGTCAGG - Intergenic
944242425 2:197499570-197499592 CCTGGACCTCGGCTGGGCGCGGG - Intronic
945908452 2:215620166-215620188 ATGGAACACCGGCTGTGAGCTGG - Intergenic
946182092 2:217955013-217955035 ACCCAACAGCGGCTGGGTGCAGG + Intronic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
948924120 2:241082898-241082920 ACTGAGCACCTGCTGTGTGCCGG + Intronic
1168753157 20:297849-297871 ACTTCCCACCGGCTGGCCGCGGG + Exonic
1168763276 20:364368-364390 ACTGAACACCTGGTAGGTGCTGG + Intronic
1168851865 20:982551-982573 ACTGAGCACCTACTGGGTGCCGG - Intronic
1169032848 20:2425042-2425064 ACTGATCAAGGGCTGGGCACAGG + Intronic
1172955473 20:38754876-38754898 AGTCAATACCAGCTGGGCGCAGG - Intronic
1173648439 20:44648230-44648252 ACTTAGCACCTGCTGGGCACTGG - Intronic
1174491442 20:50899497-50899519 ACTCATTACCGGCCGGGCGCTGG - Intronic
1175165949 20:57045003-57045025 AATCAACACCAGCTGGGCTCTGG + Intergenic
1176150732 20:63589452-63589474 CCTGAGCACCGGCTGGGGGCGGG + Exonic
1176187987 20:63791978-63792000 ACAGAACGCCGGCTGGGGGAGGG - Intronic
1178892316 21:36530464-36530486 ACTGAACACCTGCTATGTGCAGG + Intronic
1180024798 21:45154891-45154913 ACTGAGCACTGGCTGGGTGCAGG - Intronic
1180100373 21:45581192-45581214 TCTGAAATCCGTCTGGGCGCAGG - Intergenic
1180168115 21:46040508-46040530 AGGGAAGACAGGCTGGGCGCAGG + Intergenic
1180845037 22:18976211-18976233 ACTGAGCACCTGCTGTGTGCAGG - Intergenic
1180960100 22:19758679-19758701 CCTGCGCACCGGCCGGGCGCAGG - Intronic
1181056430 22:20262533-20262555 ACTGAGCACCTGCTGTGTGCAGG + Intronic
1181462361 22:23093378-23093400 ACTGAACACCCACTGTGCACTGG + Intronic
1182764821 22:32751103-32751125 CTTCAACACCGGCTGGGGGCTGG - Intronic
1183617019 22:38951906-38951928 ACTGGACATGGGCTGGGCTCTGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950150304 3:10681544-10681566 ACTGAACGCCCACTGGGTGCAGG + Intronic
950432713 3:12960172-12960194 ACTGAACACCTACTAGGTGCCGG + Intronic
950839050 3:15949398-15949420 ATTGAGCACCTGCTGGGCACTGG + Intergenic
952054739 3:29430979-29431001 ACTGAACACCTACTGTGTGCAGG + Intronic
952882318 3:37992520-37992542 ACTGAGTACCTGCTGGGGGCCGG + Intronic
954535107 3:51354133-51354155 ACTGAATACCTACTGGGCACTGG + Intronic
954539630 3:51385071-51385093 ATTGAACCCGGGCTGGCCGCAGG - Exonic
954669539 3:52281785-52281807 ACTGAGCTCTGGCTGGGCTCTGG - Intronic
964387135 3:156159854-156159876 ACTGAGCACCAGCTGTGCCCTGG + Intronic
966854080 3:184182168-184182190 ACTGAACACAAGCGGGGTGCAGG + Exonic
969335139 4:6503367-6503389 ACTGAAAACTGGCTGGGCAGGGG - Intronic
972259388 4:37393018-37393040 AGTGAACAGCGCCTGGGAGCAGG + Intronic
978636379 4:110812063-110812085 ACTGAGCACCAGCTAGGTGCAGG - Intergenic
981008918 4:139904378-139904400 ACTGAACATCTACTGGGTGCTGG + Intronic
981580265 4:146243379-146243401 ACTGAGCATCTGCTGTGCGCTGG + Intergenic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
1000217258 5:159172441-159172463 ACTGTACTCCAGCTGGGCGACGG + Intronic
1001454074 5:171847449-171847471 ACTGAACCCTGGCTGTGTGCAGG + Intergenic
1002470256 5:179430750-179430772 GCTGAGCACCTGCTGGGTGCTGG + Intergenic
1004588110 6:17022344-17022366 AGTGAACCCTGGCTGGGCGCGGG - Intergenic
1005997552 6:30940645-30940667 ACTGAGCTCTGGCTGGGAGCAGG - Intergenic
1007387347 6:41528790-41528812 GCTGAACACCTGCTGGGTCCTGG + Intergenic
1019705830 7:2496800-2496822 ACTGAGCACCTGCTGTGTGCTGG - Intergenic
1022644060 7:32214823-32214845 ATTGAGCACCACCTGGGCGCTGG + Intronic
1027249523 7:76390256-76390278 ACAGGACACCGGCTGCCCGCAGG + Exonic
1030741917 7:113119604-113119626 ACTGAGCACCTGCTGGGTGCCGG - Intergenic
1033881376 7:145887605-145887627 ACTGTATACAGGCTGAGCGCAGG + Intergenic
1034880244 7:154757370-154757392 ACTGAACACCCACTGGGCAGTGG - Intronic
1038318414 8:26507643-26507665 ACTGAAAACCACCTGGGGGCAGG - Exonic
1049108474 8:140628185-140628207 ACTGAGCACCAGCTGTGGGCAGG + Intronic
1049536656 8:143185766-143185788 CCTGAGCACCGAGTGGGCGCTGG - Intergenic
1049557843 8:143291993-143292015 ACTGCACTCCAGCTGGGCGTTGG - Intronic
1049599273 8:143499457-143499479 ACTGAACACCGGCTGGGCGCAGG - Intronic
1053311768 9:37025096-37025118 ACTGGAAACCGGTTGGGCGCAGG + Intronic
1059604143 9:115815140-115815162 ACTGAACACAGGCTGCGCCCTGG - Intergenic
1060648660 9:125305408-125305430 ACTGCACTCCGCCTGGGCGACGG - Intronic
1060910955 9:127349986-127350008 ACCGAACACCTGCTGTGTGCCGG + Intronic
1061149939 9:128822885-128822907 ACTGAAGACAGGCTGGGAGCGGG - Intronic
1061805606 9:133136088-133136110 ACTGAACACCTACTAGGTGCCGG + Intronic
1061878253 9:133555656-133555678 TCTGACCAGCTGCTGGGCGCAGG + Exonic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062394500 9:136347345-136347367 ACTGGACACGGGCTGTGCCCAGG - Intronic
1062623452 9:137432905-137432927 ACAGACCACCTGCTGGGTGCTGG + Intronic
1185823287 X:3225313-3225335 AGTGAACACCGGATGGGACCAGG + Intergenic
1192746536 X:73944261-73944283 AGTGCACGACGGCTGGGCGCCGG + Intergenic
1202262211 Y:22981740-22981762 ATTTTACATCGGCTGGGCGCTGG - Intronic
1202415201 Y:24615481-24615503 ATTTTACATCGGCTGGGCGCTGG - Intronic
1202455586 Y:25054605-25054627 ATTTTACATCGGCTGGGCGCTGG + Intronic