ID: 1049599311

View in Genome Browser
Species Human (GRCh38)
Location 8:143499726-143499748
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049599302_1049599311 14 Left 1049599302 8:143499689-143499711 CCAGCACCGGGCAGCAAGGATAC 0: 1
1: 0
2: 0
3: 1
4: 86
Right 1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG No data
1049599303_1049599311 8 Left 1049599303 8:143499695-143499717 CCGGGCAGCAAGGATACAGACAG 0: 1
1: 0
2: 0
3: 27
4: 201
Right 1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr