ID: 1049599430

View in Genome Browser
Species Human (GRCh38)
Location 8:143500143-143500165
Sequence GTGCTGAGGCCCACCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049599430 Original CRISPR GTGCTGAGGCCCACCCAGGA TGG (reversed) Intronic
900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG + Intergenic
900110072 1:1001622-1001644 GTCCTGCGGCCCACGCGGGAAGG + Intergenic
900390905 1:2433384-2433406 CTGCTGAGGCCCATCCGGGCCGG + Intronic
900682605 1:3925103-3925125 GTGCTGAGGGCCACCCAGGGTGG - Intergenic
900788745 1:4666085-4666107 CTCCTCCGGCCCACCCAGGAGGG + Intronic
900788762 1:4666137-4666159 CTCCTCCGGCCCACCCAGGAGGG + Intronic
900788779 1:4666189-4666211 CTCCTCCGGCCCACCCAGGAGGG + Intronic
901460142 1:9386458-9386480 GTGCTCCGGCCCATCCTGGAAGG + Intergenic
901604613 1:10449426-10449448 GGGCTCTGGCCCACCCAGGCTGG - Intronic
902118414 1:14140996-14141018 GTGCCCAGGCCCAACTAGGATGG + Intergenic
902810275 1:18884227-18884249 GAGCTGACGCCCACCCCAGAGGG + Intronic
902936569 1:19769065-19769087 TTGCTGAAGCCCACGCAGCAGGG - Intronic
903181234 1:21606011-21606033 GAGCTGAGGGCCCCCCAGGGAGG + Intronic
903333676 1:22611032-22611054 GTGCACATGCCAACCCAGGATGG + Intergenic
904102146 1:28040560-28040582 GCCCTGAGGCCCACCAAAGAAGG + Intronic
904384488 1:30132478-30132500 GTGCTGAGGTCCCTGCAGGAGGG - Intergenic
904673924 1:32186235-32186257 GAGCTGAGGCCTGCCCAAGAAGG + Intronic
904738224 1:32651329-32651351 GTGCCGGGGCCGACCCAGGAGGG + Intronic
905512248 1:38530637-38530659 GTGCTGAGCACCAAACAGGAAGG - Intergenic
905733790 1:40312862-40312884 GAGCCTCGGCCCACCCAGGAGGG - Intronic
905756598 1:40515304-40515326 GTGCTGAGGCATGCCCAGCAGGG + Exonic
906270010 1:44469819-44469841 GTGCAAAGGCCCTACCAGGAGGG + Intronic
906521392 1:46469034-46469056 GGGCAGAGGCCCACCCACGCAGG + Intergenic
907134186 1:52123749-52123771 GTTCTGTCACCCACCCAGGATGG - Intergenic
907634415 1:56118969-56118991 GTGCTGAGCCTCATGCAGGAGGG + Intergenic
908095439 1:60732628-60732650 GTGCTGAAGTGCATCCAGGATGG - Intergenic
909166179 1:72228253-72228275 GGGCTGATGCCCACCCATGTTGG - Intronic
911778635 1:101846873-101846895 GTGTTCAGTCCCACCAAGGATGG + Intronic
912058238 1:105632066-105632088 GTGCTGAGGCTCTCCCTGGCAGG - Intergenic
912094424 1:106121027-106121049 GGGCTGAGGGCCACTCAGCATGG + Intergenic
915924326 1:160004513-160004535 GGGCTAAGGCCTGCCCAGGAAGG - Intergenic
916644600 1:166770504-166770526 GTGCTGAGGTCCTGCCATGAAGG - Intergenic
919251784 1:195065873-195065895 GAGCTTGGGCCCACCCAGAAAGG - Intergenic
920039226 1:203085102-203085124 CTGCTCAGCCACACCCAGGATGG + Intronic
920096092 1:203487565-203487587 CTCCTGAGGCCCAGCCAGGAGGG - Exonic
920677484 1:208048312-208048334 GAGCTGGGGCCCAACCAGGCAGG + Intronic
920916979 1:210265721-210265743 GTGCTGAGCCACATCCTGGAAGG + Intergenic
923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG + Intronic
923415218 1:233749948-233749970 GTGGTGAGGCCAATCCTGGAAGG + Intergenic
1063351660 10:5362436-5362458 ATGCCAAAGCCCACCCAGGATGG + Intergenic
1063814317 10:9755597-9755619 ATGCTAATGTCCACCCAGGAGGG - Intergenic
1067077134 10:43194415-43194437 CTGCTGTGGCCTTCCCAGGAGGG - Intergenic
1068544156 10:58327355-58327377 GTCCTGAGGCACAGCCAGGGTGG + Intergenic
1069784284 10:70977858-70977880 ATCCTGAGGCCCACCCATCAGGG - Intergenic
1071027658 10:81135661-81135683 AGGCTGAGGCCCACCAAGCAGGG - Intergenic
1072097982 10:92201157-92201179 GAAATGAGGCCAACCCAGGAAGG + Intronic
1072429270 10:95356520-95356542 GAGCTGGGCCCCAGCCAGGAGGG - Intronic
1073760147 10:106620468-106620490 GTGCTGTGGCCCAGCCAAGTGGG - Exonic
1074162798 10:110847712-110847734 GGGGAGAGGCCCACCAAGGATGG + Intergenic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1075949322 10:126463325-126463347 GGGCTGAGGCCCAGCCGGCAAGG - Intronic
1076479028 10:130772274-130772296 TTGCTGTGGCCCTCCAAGGAAGG - Intergenic
1076598497 10:131641289-131641311 ATGCTGAGGTCACCCCAGGAGGG + Intergenic
1076684110 10:132189227-132189249 GTGCTGAGGCGCACGCCAGACGG + Intronic
1077178654 11:1202696-1202718 GGCCTGTGGCCCACACAGGAAGG + Intergenic
1077285671 11:1764178-1764200 GTGGGGCGGCCCACCCTGGAGGG + Intergenic
1077326202 11:1965164-1965186 GGGCCCTGGCCCACCCAGGATGG + Intronic
1077392345 11:2305804-2305826 GTGCTGGAGCCCACCCAGCTGGG - Intronic
1078452793 11:11452891-11452913 GGGCTGAGGACTCCCCAGGAGGG + Intronic
1079390731 11:20019744-20019766 GGGATGAGGCCCACTCAAGAAGG + Intronic
1083330915 11:61897979-61898001 GGGCTGAGGCCCCCCGAGTATGG + Exonic
1083332764 11:61906572-61906594 CTGCTGAGCCCCACCAAGGCCGG - Exonic
1083681858 11:64355044-64355066 GTGCTGAGGCTCCTGCAGGAAGG - Intronic
1083776873 11:64898306-64898328 GCACTCAGGCCCACCCAGGTTGG + Exonic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084653531 11:70502487-70502509 CTGCCCAGGCCCACCCATGAGGG - Intronic
1084904630 11:72336066-72336088 GTGCTGAATCCCACCTAGGGAGG + Intronic
1085151435 11:74255396-74255418 GTGTGGAGGACCACCCAGGGGGG - Intronic
1085520640 11:77137282-77137304 GGGCTCAGAGCCACCCAGGATGG - Intronic
1088352806 11:108909289-108909311 GGACGGTGGCCCACCCAGGAAGG + Intronic
1088665119 11:112086579-112086601 GTGCCCAGGACCACCAAGGAAGG + Intronic
1090808262 11:130216379-130216401 GGGACCAGGCCCACCCAGGAAGG + Intergenic
1091122259 11:133066015-133066037 GTTCTCAGGCCCACAGAGGATGG - Intronic
1091160114 11:133412231-133412253 TTGGAGAGGCCCACCTAGGAGGG + Intronic
1091283108 11:134393351-134393373 GTGCTGAGAGCCAGCAAGGATGG - Intronic
1202809183 11_KI270721v1_random:20343-20365 GGGCCCTGGCCCACCCAGGATGG + Intergenic
1092281024 12:7097672-7097694 GTCCTGAGTCCCATGCAGGATGG - Intronic
1092669771 12:10849534-10849556 GTGGTGAGGTCCACCCAGTATGG - Intronic
1092704727 12:11269766-11269788 GTGGTGAGGCCCACCCAGTGTGG - Exonic
1092712841 12:11355650-11355672 GTGGTGAGGCCCACCCAGTGTGG - Intronic
1092716637 12:11395626-11395648 GTGGTGAGGCCCACCCAGTGTGG - Intronic
1095048561 12:37535954-37535976 GTCCTGTGGCCAACCCAGGGCGG + Intergenic
1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG + Intronic
1096802544 12:54120688-54120710 GTGCTGAGGGACACACAGGAGGG - Intergenic
1101440999 12:104704277-104704299 GTGCTCAGGGAGACCCAGGAAGG + Intronic
1102684454 12:114713838-114713860 GGCCTGGGGCCCACCCAGAATGG + Intergenic
1104738463 12:131154575-131154597 GGGCTGAGCCACAGCCAGGAGGG - Intergenic
1104965972 12:132509004-132509026 GCGCAGAGCCCCACCCTGGAAGG - Intronic
1106235695 13:27858466-27858488 GGCCTAAGCCCCACCCAGGATGG + Intergenic
1107761823 13:43687817-43687839 GTGCTATGGGCCACACAGGAAGG + Intronic
1109024338 13:57140501-57140523 GTGCTGAGGCCCGGACTGGAAGG - Intergenic
1109025325 13:57147071-57147093 GTGCTGAGGCCCGGACTGGAAGG - Intronic
1109026315 13:57153644-57153666 GTGCTGAGGCCCGGACTGGAAGG - Intronic
1109027307 13:57160215-57160237 GTGCTGAGGCCCGGACTGGAAGG - Intergenic
1109028293 13:57166780-57166802 GTGCTGAGGCCCGGACTGGAAGG - Intergenic
1109029280 13:57173351-57173373 GTGCTGAGGCCCGGACTGGAAGG - Intergenic
1110501181 13:76230754-76230776 TAGCTGATGCCCACCCATGAAGG + Intergenic
1113408905 13:110066342-110066364 GTGCTGAGTCCCACCCAGTCTGG + Intergenic
1113597736 13:111546561-111546583 TTGCAAAGGCCCACCCTGGATGG - Intergenic
1113625708 13:111844939-111844961 GCACGGAGACCCACCCAGGATGG - Intergenic
1113932730 13:113976795-113976817 GTGCTGGGGTCAGCCCAGGAGGG - Intergenic
1114472439 14:22973187-22973209 GAGCTTAGGCACACACAGGAGGG - Exonic
1114814606 14:25942737-25942759 GAGTAGAGGCCCACCAAGGACGG + Intergenic
1115658453 14:35466556-35466578 GTGCTGAGTCCACCCCAGGTAGG + Intergenic
1115977166 14:39009397-39009419 GTGCTGAGTTCCACCTAGGCAGG + Intergenic
1116164004 14:41310677-41310699 ATTCTGAGGCCTCCCCAGGAAGG + Intergenic
1117294957 14:54370787-54370809 ATCCTGAAGCCCACCCAGAAAGG + Intergenic
1118719464 14:68583934-68583956 GTGCTGTGGCCCACACATTAGGG - Intronic
1119484746 14:74980126-74980148 GTGCTTACGTCCGCCCAGGAGGG - Intergenic
1121244158 14:92450449-92450471 CTGCTGAGGCCCACCCACAAAGG + Intronic
1121586716 14:95067879-95067901 GGGCAGAAGCTCACCCAGGAGGG - Intergenic
1121614153 14:95301615-95301637 GGTCTGCTGCCCACCCAGGATGG + Intronic
1122250480 14:100435818-100435840 GTGCTGTGGATCACCTAGGAGGG + Intronic
1122365293 14:101191576-101191598 GTGTTGAGGCCAAACCTGGAAGG + Intergenic
1122691795 14:103535136-103535158 CTGCTTAGGCCCACCTGGGAGGG - Exonic
1122693258 14:103541375-103541397 GTGTTGAAGCCCCACCAGGAGGG - Intergenic
1123059100 14:105586408-105586430 GTCCTGAGGCCCACCCACTAGGG + Intergenic
1123083429 14:105706639-105706661 GTCCTGAGGCCCACCCACTAGGG + Intergenic
1124225274 15:27888038-27888060 GTTCTGAGGCCCCCACAGGAAGG + Intronic
1124693594 15:31845608-31845630 ATGTTGAGGCCCCCTCAGGAAGG + Intronic
1124809619 15:32922131-32922153 ATCCTCAGGCACACCCAGGATGG - Intronic
1125528360 15:40394053-40394075 GTACAGAAGCCCAACCAGGATGG - Exonic
1125738910 15:41947867-41947889 GTGCAATGGCCCAGCCAGGAAGG + Intronic
1127148284 15:56048308-56048330 GTGCTGAGGCCCTCTTAGGCTGG - Intergenic
1128735876 15:70053655-70053677 CTCCAGAGGCCCACCCTGGAGGG - Intronic
1130707334 15:86245750-86245772 GTTCGGAAGCCCACCCAGCAGGG - Intronic
1131761402 15:95626870-95626892 GGGCTGGTGCTCACCCAGGAGGG - Intergenic
1132659175 16:1053954-1053976 GTGCTGAGACAGACCCAGCAAGG - Intergenic
1132982405 16:2745242-2745264 GTGCAGAGGCCCCTCCAGGCAGG - Intergenic
1133887719 16:9846184-9846206 GAGGTGGGGCCCACCAAGGAAGG - Intronic
1136417296 16:30112052-30112074 GAGCTGGAGCCCACCCAGCATGG - Intronic
1136589614 16:31209894-31209916 GTGCTGAGGCCCAGAGAGGCAGG + Intergenic
1138507174 16:57484204-57484226 GTGGGGAGGCCCAGCCAGGCAGG - Intronic
1138638419 16:58362505-58362527 CGGCTGATGCCCACCCAGGGAGG - Intronic
1138654251 16:58481695-58481717 CTCCTGTGGCCAACCCAGGAGGG - Intronic
1139523345 16:67497869-67497891 GAGCTGTGGCCAACCCAGGGAGG + Intergenic
1140432078 16:74912978-74913000 GTGGTGATGCCCACGCTGGAAGG - Intronic
1141834960 16:86532380-86532402 GTGCTGGTGCTCACCCTGGAGGG + Exonic
1141997799 16:87646167-87646189 GGGCTGAGCCGCACCCAGGCTGG - Intronic
1142215202 16:88826491-88826513 GTGCTTGGACCCTCCCAGGATGG + Intronic
1142239451 16:88938535-88938557 GCTCTAAGACCCACCCAGGAAGG + Intronic
1143115044 17:4577340-4577362 GCTCTGAGGGCCACCCAGGCTGG + Intergenic
1143975023 17:10823330-10823352 CCGTTGAGGCTCACCCAGGATGG - Exonic
1146353000 17:32111532-32111554 GTGCTGTGGCGCCCCCAGCAGGG + Intergenic
1146521568 17:33529355-33529377 GGGCTGAGAACCACCAAGGATGG + Intronic
1148784338 17:50138207-50138229 GTGCTGATGCCGACCCCAGATGG - Intronic
1149606788 17:57930755-57930777 GTGCTGTGGCCAACACAGGAGGG + Intronic
1151440968 17:74128856-74128878 CTGCAGAGGACCACACAGGAAGG + Intergenic
1151490691 17:74431072-74431094 GGGCTGAGGCGCACAGAGGAGGG - Exonic
1151944580 17:77312421-77312443 GTGCTCGGGCCCCCCCTGGATGG + Intronic
1152233620 17:79127044-79127066 GTGCTGAGGAGCAGCCAGGATGG - Intronic
1152431146 17:80248813-80248835 TGGCTGAGGCCCACAGAGGACGG - Intronic
1152881099 17:82815680-82815702 GTGGTGAGGCCCTCTCAGGATGG - Intronic
1152923723 17:83078582-83078604 GTGCCGAGGGCCCCCCAGGCAGG - Intergenic
1155163771 18:23216506-23216528 GTGCTAGGGCCCACTCAGCAAGG + Intronic
1155537266 18:26830393-26830415 TTGCTGATGCCCAGCCAGGTTGG + Intergenic
1156447657 18:37249210-37249232 GCCCTTAGACCCACCCAGGATGG + Intronic
1157818347 18:50747474-50747496 GTGAATAGGCCAACCCAGGAAGG - Intergenic
1158392190 18:57052783-57052805 GTCCTGAGACACAACCAGGATGG + Intergenic
1159886721 18:73914610-73914632 GTGCTGAGGCCCAATAATGAGGG - Intergenic
1160532451 18:79573511-79573533 GAGCTGATGCCCACCCAGCGTGG + Intergenic
1160664024 19:314591-314613 GTGCTGTGCCCCACCAAGCAGGG + Intronic
1160678249 19:401698-401720 GTGTCCAGTCCCACCCAGGAAGG + Intergenic
1165689947 19:37855516-37855538 GTTCGGAGACCCACACAGGAGGG + Intergenic
1165771107 19:38380821-38380843 GTGATGAGGCCCACACAGGTAGG + Intronic
1165832820 19:38737552-38737574 GTGCTGGGCCCCAGCCCGGAGGG - Exonic
1166143468 19:40818666-40818688 GCGATGAGGCCCACCCATGTGGG - Intronic
1166390638 19:42407160-42407182 GGCCTGAGGCTCACCAAGGAGGG + Exonic
1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG + Exonic
924969245 2:109138-109160 CTGCTGGGTCCCACCCAGGACGG + Intergenic
925042209 2:740588-740610 GGGGTGTGGCCCAGCCAGGAGGG + Intergenic
925291025 2:2748826-2748848 GAGGTGAGGCCCACCTGGGAGGG + Intergenic
925357706 2:3253792-3253814 GTGCTGAGACAGACACAGGAGGG + Intronic
927323657 2:21778032-21778054 GAGTTGAGGCCCACAAAGGATGG - Intergenic
927565025 2:24104447-24104469 GTGTTGAGTCCTACCCAGCATGG - Intronic
928124688 2:28607300-28607322 GTGGTGTGGCCGACCTAGGAGGG - Intronic
931790380 2:65659046-65659068 GTGCTGTGGTCCACACTGGAAGG + Intergenic
932469457 2:71944406-71944428 TTCCTGATGCCCACCCAGGCAGG - Intergenic
933856364 2:86418285-86418307 GTTCAGAGGGCCACCCAGCAGGG + Intergenic
933997144 2:87678410-87678432 ATGCTCAGGCCTGCCCAGGATGG - Intergenic
936296706 2:111272500-111272522 ATGCTCAGGCCTGCCCAGGATGG + Intergenic
938062205 2:128262703-128262725 GAGGTGAGGCCCTCCTAGGAAGG + Intronic
942734836 2:179097512-179097534 CAGCTGATGCCCACCCTGGAGGG - Intergenic
942866721 2:180685418-180685440 TTCCTGAGACCCCCCCAGGAAGG + Intergenic
943541466 2:189220136-189220158 CAGCTGAGGCCCACCCTGAAGGG + Intergenic
946171021 2:217895637-217895659 CTGATTGGGCCCACCCAGGATGG - Intronic
947583521 2:231336902-231336924 GAGCTGAGGCCCTCCTAGGCTGG + Intronic
948365290 2:237450759-237450781 GTGGTGATGCCCAGCCAGGTGGG + Intergenic
948615759 2:239197881-239197903 GTGCTGAGTGTCACCCAGGCTGG + Intronic
948698355 2:239745473-239745495 GGCCTGAGGCCCACCCTGGCAGG + Intergenic
948727223 2:239942286-239942308 CTGCTGGGGCCCACCCACCAGGG + Intronic
948734363 2:239990668-239990690 ATGCTGAGGCCAACATAGGATGG + Intronic
1169128335 20:3147346-3147368 GTACTGGGGCCCCCCCAGCATGG + Exonic
1169130209 20:3162904-3162926 CTGGTGAGGACCACCCAGAAGGG + Exonic
1169572965 20:6926641-6926663 GTGCTCAGGATCACCCAGGATGG - Intergenic
1170562706 20:17570386-17570408 GCGCGGGGGCCCAGCCAGGACGG - Intronic
1171290973 20:23982614-23982636 GACCTGAGGCACAGCCAGGAAGG + Intergenic
1171794201 20:29553898-29553920 GTGCTGAGGGACACACAGGAGGG + Intergenic
1171854270 20:30330493-30330515 GTGCTGAGGGACACACAGGAGGG - Intergenic
1172271382 20:33657498-33657520 GGCCTGAGGCCCACCCAGACAGG + Exonic
1172621759 20:36322057-36322079 GTGATGAGGCCCACGGAGGAGGG + Intronic
1173669971 20:44792039-44792061 GTGCTGAGTCCCACCTTGAAGGG - Intronic
1174173600 20:48631718-48631740 GTGGTGAGACACACGCAGGAAGG + Intronic
1176231786 20:64036617-64036639 CTGCTGTGTCCCACCCAGGTGGG - Intronic
1179176088 21:39009332-39009354 GTTCTGTGGCTCCCCCAGGATGG - Intergenic
1179279307 21:39920890-39920912 GGGCTGTGCCCCTCCCAGGATGG + Intronic
1179646188 21:42777750-42777772 GTGATGATGGCCTCCCAGGACGG - Intergenic
1179978246 21:44882932-44882954 GTGGTGATGCCCTCTCAGGAAGG - Intergenic
1180963629 22:19774265-19774287 GTGCCTAGGCCCGCCCAGGCGGG - Intronic
1180995717 22:19964297-19964319 GAGGTGAGCCCCAACCAGGATGG + Exonic
1181001181 22:19988481-19988503 GGGCTGACGCCCACCCAGTGGGG - Intronic
1181032827 22:20156510-20156532 GTCCAGAGACTCACCCAGGAGGG - Intergenic
1181510493 22:23386746-23386768 GTCCAGAGCCTCACCCAGGAGGG + Intergenic
1181631181 22:24152184-24152206 CTGCTGTGGCTGACCCAGGAAGG + Intronic
1181809516 22:25394945-25394967 GTCCTCAAGCCCACCCAGGCTGG + Intronic
1181845897 22:25708352-25708374 CTGCACAGGCCCAGCCAGGATGG - Intronic
1182074916 22:27488735-27488757 AAACTGAGGCCCACCCAGCAGGG - Intergenic
1182575160 22:31268020-31268042 ATGCTCAGTCCCACCCAGCATGG - Intronic
1183615822 22:38944737-38944759 CTGCTGGGGACCACTCAGGAAGG + Intergenic
1183654880 22:39178893-39178915 GTCATGAGGCCCCCTCAGGAGGG + Intergenic
1183706732 22:39478965-39478987 AGGCTGAGGCTGACCCAGGATGG - Intronic
1183730380 22:39615178-39615200 TTGCTGAGGGCCACCTGGGATGG - Intronic
1184103232 22:42352550-42352572 CTGCTGAGGCCCACTGGGGAAGG - Intergenic
1184741142 22:46429752-46429774 GGGCTGCGGACCACCCAGGAGGG - Intronic
1184813043 22:46850177-46850199 GTGCTGAGGGGCACGCAGGAGGG + Intronic
1184984386 22:48119455-48119477 GTGCTGTGGCACCCCCAGGTGGG - Intergenic
1185333578 22:50261970-50261992 CTGCTGAGACCCCCCCAGGGCGG - Intergenic
949509628 3:4756975-4756997 AAGCTGGGGCCCACCCAGCAAGG - Intronic
950429933 3:12944878-12944900 GTGCTGCCCCCGACCCAGGATGG + Intronic
951040232 3:17981559-17981581 GTGCTGAGGGCACCCCAGGGAGG + Intronic
953909579 3:46884875-46884897 GTGCTGAGGACCTCAGAGGAAGG - Intronic
954698625 3:52440425-52440447 GTGCTGAGGCCCATCTCGGTGGG + Exonic
954791984 3:53140034-53140056 GGGCTGAGGCCAAGCCAGGATGG - Intergenic
955702244 3:61693520-61693542 GTGCTGAGGAGTACCCAGGGAGG + Intronic
960370210 3:116827190-116827212 GTTCTGAGGCACATCCTGGAAGG + Intronic
961380986 3:126496439-126496461 GTGTTGAGGGCTCCCCAGGATGG + Intronic
961603543 3:128077592-128077614 TAGCTGAGCCTCACCCAGGATGG + Intronic
961812406 3:129529488-129529510 GTGCTGAGTCAGACCCAGGCTGG + Intronic
961831162 3:129623656-129623678 CTGCTGAGGTCAACCCTGGAGGG - Intergenic
962852586 3:139319043-139319065 CTGCTGCTGACCACCCAGGATGG + Intronic
964549479 3:157870845-157870867 GGGCAGAGGCCCACCCTCGATGG + Intergenic
968735244 4:2291798-2291820 ACGCTGGGGCCCACCCAGGCAGG - Intronic
968819240 4:2837402-2837424 GCGCTGAGCCCCAACCAGCAGGG - Exonic
969636847 4:8374312-8374334 GTGCTCAGGTGCACCAAGGAAGG - Intronic
970951008 4:21755262-21755284 GGGCTGAGGCCTACCCACCAAGG + Intronic
976225662 4:82794142-82794164 ATGCTGAATCCCACTCAGGATGG + Intronic
981347539 4:143694205-143694227 GTGCTGAAGCCCAGCAAGGAGGG + Intronic
983631064 4:169849768-169849790 GAGCTAAGGCCCTCACAGGAAGG + Intergenic
984820389 4:183876594-183876616 GTGCTGAGGCCCCACCTGTATGG + Intronic
985496321 5:208603-208625 GTGCTGAGGCCTTCCCAGCCGGG + Intronic
985540590 5:485725-485747 GGGCCTCGGCCCACCCAGGACGG - Intronic
985661613 5:1160018-1160040 TTGTTGAGGCTCCCCCAGGAGGG - Intergenic
987037538 5:14033165-14033187 GAGCTGAGGCCAGCTCAGGAAGG - Intergenic
991078928 5:62573850-62573872 GTGCTGAAGACCACCCAATACGG - Intronic
992148892 5:73880900-73880922 CTTCTGATGCCCACCCAGGCTGG - Intronic
992314364 5:75537084-75537106 TTGCTGAGCCCCATCCAGCAAGG + Intronic
995574453 5:113514204-113514226 CCGCTGAGGCCCGCCCCGGACGG - Intronic
997361530 5:133298381-133298403 GTGGGGAAGCCCACCCACGATGG - Intronic
997625324 5:135327233-135327255 ATGCGGAGGCCCTCGCAGGAAGG - Intronic
999140537 5:149358346-149358368 GTGAAGAGGGCCACCTAGGACGG + Intronic
999239247 5:150118040-150118062 GAGCTCAGGACCACCCAGGGAGG + Intronic
1001506454 5:172283949-172283971 GCGCTGCGGCCCGCCCGGGATGG - Exonic
1004404837 6:15323351-15323373 GTGCTGTAGCACACCCAGGCTGG - Intronic
1006115949 6:31776341-31776363 GTCCTGAGCCCCACAAAGGAGGG + Intronic
1008036920 6:46754922-46754944 ATGCTGAGGTCCACAGAGGATGG - Intronic
1008619919 6:53261724-53261746 GTGCTGTGGTCCACACAGGAAGG + Intergenic
1012977970 6:105800306-105800328 TTCCTGAGGCCCCCCCAAGAGGG + Intergenic
1015925648 6:138307997-138308019 GTGCTCTCGCCCTCCCAGGAGGG + Intronic
1017216137 6:151909675-151909697 GGGCTGAGGTGCACCTAGGAAGG + Intronic
1017437989 6:154435755-154435777 GTGCTGAGTGCCACCCAGGCTGG - Intronic
1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG + Intergenic
1018420048 6:163633326-163633348 GTGGAGAGGCCCACCCGGCAAGG - Intergenic
1018847636 6:167566487-167566509 GTGCTGAGGCTAACCCAGGCAGG - Intergenic
1019383154 7:738863-738885 CTGCGGGGCCCCACCCAGGACGG - Intronic
1019386245 7:757795-757817 GAGCTGAGGCCCGCCCTGCATGG - Intronic
1019552592 7:1610585-1610607 GGGCTGAGGCCCACCCAGCGAGG + Intergenic
1019889775 7:3937164-3937186 ATGCGGAGGTCTACCCAGGAAGG + Intronic
1021809363 7:24388360-24388382 GTGCAGAGTGGCACCCAGGAAGG - Intergenic
1022484876 7:30770771-30770793 TTGCTGAGGCCCACACAGCTGGG - Intronic
1023617655 7:42036779-42036801 GTGCTGATGCCCACCAGGCACGG + Intronic
1023871936 7:44268034-44268056 GTGCTGAGGCACAGGCAGGCTGG + Intronic
1029490745 7:100868668-100868690 GGGCTGCGGCCCACCCAGGCGGG + Exonic
1032889658 7:136181061-136181083 GTGCTGAGACCCATGCAGGCAGG + Intergenic
1033448511 7:141442130-141442152 GTACTGAGGTGCACCCAGCAAGG - Intronic
1034567601 7:151927663-151927685 GCACAGAGGCTCACCCAGGAAGG + Intergenic
1035075594 7:156175311-156175333 GGGCTGAGAACCACGCAGGAAGG - Intergenic
1035465239 7:159070889-159070911 GTGCTGAAGCACACGCAGGTGGG + Intronic
1036705459 8:11043038-11043060 GGGCTGGGGCCCACCCAGAGGGG + Intronic
1036808664 8:11852618-11852640 TGGCTTGGGCCCACCCAGGAAGG + Exonic
1036993442 8:13627088-13627110 CCCCTGAGTCCCACCCAGGAAGG + Intergenic
1037603724 8:20420398-20420420 GTGCTGAGGCCCATCCCTGAGGG + Intergenic
1038181828 8:25236253-25236275 CTGCTCAGACCCATCCAGGACGG - Intronic
1039379440 8:37071254-37071276 GTGATGAGGCCCACTCTGCACGG + Intergenic
1039560157 8:38506030-38506052 GTTCTGCAGCCCACCAAGGACGG + Intergenic
1039634065 8:39144019-39144041 CTGCTGAGGCAGACACAGGAGGG + Intronic
1040511619 8:48100861-48100883 CAGCTGATGCTCACCCAGGAAGG - Intergenic
1040572705 8:48624544-48624566 GCTCTGAGGCCCGCCAAGGATGG - Intergenic
1045064140 8:98430666-98430688 GTGGTGTGGCTTACCCAGGATGG + Exonic
1045501159 8:102745436-102745458 TTGCTGAGGCCCAGACAGGGTGG - Intergenic
1049275582 8:141718553-141718575 GTGCTGAGGCCCAGAGAGGATGG - Intergenic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1051335295 9:16060453-16060475 GGGCTGAGGCCCAGCCTGGGGGG - Intronic
1053282028 9:36826672-36826694 GTGGAGAGGACCACCCAGCAGGG - Intergenic
1053364864 9:37515718-37515740 GGGCTGAGGACTCCCCAGGAGGG - Intronic
1053792080 9:41693772-41693794 GTGCTGAGGGACACACAAGAGGG - Intergenic
1054153080 9:61620993-61621015 GTGCTGAGGGACACACAGGAGGG + Intergenic
1054161947 9:61679767-61679789 GTCCTGTGGCCAACCCAGGGCGG - Intergenic
1054180487 9:61905792-61905814 GTGCTGAGGGACACACAAGAGGG - Intergenic
1054472868 9:65552197-65552219 GTGCTGAGGGACACACAAGAGGG + Intergenic
1054657104 9:67675350-67675372 GTGCTGAGGGACACACAAGAGGG + Intergenic
1056048201 9:82741002-82741024 GTTCTCAGGCCGACTCAGGAAGG - Intergenic
1056768625 9:89460785-89460807 GTGCTGAGTTCCACGCTGGAGGG - Intronic
1056891846 9:90501716-90501738 ATGCTGAGGTCCATCCAGTATGG + Intergenic
1057583133 9:96305334-96305356 GTGAGGAGGCCCACACAGCAAGG - Intergenic
1059393886 9:114018268-114018290 GTGCTGATGCCCAGGCAGCAGGG + Intronic
1060043818 9:120324660-120324682 GTGCTGTGCCCCAGCAAGGATGG - Intergenic
1060529996 9:124342436-124342458 CACCTGAGGCCCACCCGGGAGGG - Intronic
1060942872 9:127553384-127553406 CTGCTGAGGCTCCTCCAGGAGGG + Intronic
1061179203 9:129013996-129014018 GTGCTCAGGCGCCCCCACGATGG - Intronic
1061423339 9:130484022-130484044 CCCCAGAGGCCCACCCAGGATGG + Intronic
1062162528 9:135088068-135088090 GTGTTGAGGCCCACCAGCGAGGG - Exonic
1062191260 9:135249060-135249082 GGGGTGGGGGCCACCCAGGAAGG - Intergenic
1062309930 9:135930123-135930145 GGGCTGAGGCTGACCCAGGCAGG + Intergenic
1062547831 9:137071519-137071541 CAGCTGAGGCCTGCCCAGGAGGG - Intergenic
1186191397 X:7070405-7070427 GTCCTGAGGCCCACAGAGGGTGG + Intronic
1186198541 X:7133262-7133284 GAGGTGAGGCCCAGCCAGGGAGG + Intronic
1189896439 X:45661351-45661373 TTGCCGAAGCTCACCCAGGAAGG - Intergenic
1190801240 X:53791074-53791096 ATGCTGAAACCCACACAGGAAGG + Intergenic
1192202024 X:69072565-69072587 GTCCTGGGGCCCATCCTGGAAGG - Intergenic
1192453077 X:71255306-71255328 ATGCTAAGGACCATCCAGGAGGG - Intergenic
1193293497 X:79806062-79806084 CAGCTGATGCCCACCCAGGGAGG - Intergenic
1197701745 X:129605011-129605033 TTGCTGAGTCCCACCAAGAATGG + Intergenic
1197768512 X:130074312-130074334 GTACTGAGGGACAGCCAGGAAGG + Intronic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1200764751 Y:7070969-7070991 GTACTCAGGCCCAACCTGGAGGG + Intronic
1200869113 Y:8078041-8078063 GTGGTGAGCAGCACCCAGGAAGG + Intergenic
1200984876 Y:9293915-9293937 GTCCTGTGGCCAACCCAGGGAGG - Intergenic
1202125562 Y:21566272-21566294 GTCCTGTGGCCAACCCAGGGAGG + Intergenic
1202153446 Y:21863120-21863142 GTCCTGTGGCCAACCCAGGGAGG - Intergenic