ID: 1049601095

View in Genome Browser
Species Human (GRCh38)
Location 8:143508037-143508059
Sequence GTGTGTGCCACATGGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049601095_1049601101 -6 Left 1049601095 8:143508037-143508059 CCCTCAACCCATGTGGCACACAC 0: 1
1: 0
2: 3
3: 7
4: 153
Right 1049601101 8:143508054-143508076 ACACACATCCCCAGGGCGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 202
1049601095_1049601105 10 Left 1049601095 8:143508037-143508059 CCCTCAACCCATGTGGCACACAC 0: 1
1: 0
2: 3
3: 7
4: 153
Right 1049601105 8:143508070-143508092 CGCCTGGCAGCCGACGCTTCAGG 0: 1
1: 0
2: 2
3: 72
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049601095 Original CRISPR GTGTGTGCCACATGGGTTGA GGG (reversed) Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900690530 1:3977893-3977915 GGGAGGGCCACAGGGGTTGAGGG + Intergenic
901060554 1:6470010-6470032 GTTGGTGCCACATGGGTTCCTGG - Intronic
901762919 1:11482201-11482223 GTGTCTGCCACTTGGGAGGAAGG - Intronic
908571768 1:65418872-65418894 GTGTATGCCACTTTGGTTTAAGG - Intergenic
909037384 1:70609410-70609432 ATGAGTGCCACATGGGGTGTTGG - Intergenic
910751303 1:90634088-90634110 TTCTGTCCCACATTGGTTGAGGG + Intergenic
912328555 1:108794546-108794568 GTGTTTGGAACATGGGATGATGG - Intronic
914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG + Intergenic
917409819 1:174747953-174747975 GTATGTGCCAGATGGGGTCAGGG - Intronic
917842790 1:178995602-178995624 CTGTGTCCCACAAGGGGTGAGGG + Intergenic
918147016 1:181765919-181765941 TTTTGTGCCACATGGCTTCATGG + Intronic
919805384 1:201378250-201378272 GGGTGTGCCACATGGCTTTGGGG - Intronic
920272829 1:204779361-204779383 GTTTGTCCCACATGGATTTATGG - Intergenic
920615281 1:207486325-207486347 GTGTGTGCCAGCTGTGTTGGCGG + Intronic
921162888 1:212485524-212485546 GTGGGTGGCACATGTGTTGGGGG + Intergenic
922701193 1:227762114-227762136 GTGTGTGCCACATGGCAAGATGG - Intronic
923098215 1:230792405-230792427 GTCTGTGCCATGTGGGTTAAGGG - Exonic
1064168568 10:13007970-13007992 GTGTGAACCACAAGGGGTGAGGG + Intronic
1064773248 10:18747328-18747350 GTGTCTGCCCCCTGGGTTCAAGG + Intergenic
1067234829 10:44438854-44438876 GTGTGTGTCACATGCATTGAGGG - Intergenic
1068059841 10:52053114-52053136 GTGTGTGCAGGATGGGTTGGTGG + Intronic
1068221853 10:54055681-54055703 GTATGTGAGACATGGGTGGATGG - Intronic
1069200934 10:65615635-65615657 GTGTGTGACACATGTGCTCATGG + Intergenic
1069564860 10:69457081-69457103 GTGTGTCCCCAATGGGCTGAGGG - Intronic
1069967725 10:72135295-72135317 CTGGGTGCCACATGCCTTGAAGG + Intronic
1070148103 10:73789200-73789222 GGATGTGCCACATGGCATGATGG - Intronic
1073581292 10:104667997-104668019 GTGTTTGCCACTTGAGTTCAAGG + Intronic
1075564333 10:123492657-123492679 TGGTGAGCCTCATGGGTTGAGGG + Intergenic
1076052526 10:127346996-127347018 GTGTGTGCCGCGTGGCCTGAAGG - Intronic
1076055140 10:127366702-127366724 GTGTGTGGCACATTGGTGCAGGG + Intronic
1076152364 10:128172814-128172836 GTGTGTGGCAGAGAGGTTGAAGG + Intergenic
1076802781 10:132839084-132839106 GTGTGTCCCACATGGATGAAGGG - Intronic
1089320750 11:117625169-117625191 GTGGGGGCCTCATGGGTTGCTGG + Intronic
1093745092 12:22731329-22731351 GTGGCTGACACATGGCTTGAAGG - Intergenic
1100948210 12:99812498-99812520 GTGTGTGTGGCATGGGGTGATGG - Intronic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1101743985 12:107523894-107523916 GTGTGGGCCACATGGTGTGAGGG - Intronic
1104289495 12:127455352-127455374 GTGTGTCCCACATAGGCTGGGGG + Intergenic
1108789154 13:53945698-53945720 GTGTGTGTGACATGTGTTTAGGG - Intergenic
1109873368 13:68365940-68365962 GTGTGTGGCCCATGGGCTGTGGG - Intergenic
1109937610 13:69312021-69312043 GTGTGTCCCAAATTGGTTGCAGG - Intergenic
1110148676 13:72224181-72224203 ATGTGTGCCACCTGGATTCAGGG - Intergenic
1113874916 13:113588227-113588249 AGCTGTGCCACTTGGGTTGAAGG + Intronic
1118833612 14:69459054-69459076 ATCTATGCCACATGCGTTGATGG + Exonic
1120722534 14:87904402-87904424 GTGGGAGGCACATGGGTGGATGG + Intronic
1126065383 15:44822482-44822504 CTGTGTGCCACAGGGGATCAGGG + Intergenic
1126094451 15:45078112-45078134 CTGTGTGCCACAGGGGATCAGGG - Intergenic
1127193533 15:56559951-56559973 GTGGGTGCCTCATGAGCTGAGGG + Intergenic
1131586981 15:93705908-93705930 GTGCCTGGCACATGTGTTGAAGG - Intergenic
1134624882 16:15716472-15716494 GTGTGTACCAAATGGGCTGCCGG + Intronic
1138264786 16:55652603-55652625 GTGTTTGCTACAAGGGTGGAGGG - Intergenic
1140004638 16:71062801-71062823 GAGTGTGCCAGATGGGTTGATGG - Intronic
1140480295 16:75258833-75258855 GTGTGTGCCTCCTGGGCTTAGGG + Intronic
1141225458 16:82110787-82110809 GTGTGGGCCAGGTGGGTAGAGGG - Intergenic
1141367431 16:83456567-83456589 GAGTGTGCCAGATGGGCTAATGG + Intronic
1144627145 17:16849795-16849817 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1144879292 17:18422917-18422939 GAGTGGGCCACAGGGGTTTATGG - Intergenic
1145152945 17:20521470-20521492 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1147581286 17:41628480-41628502 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1147626377 17:41903161-41903183 GTGTGTGCCACATCTGGTGGTGG - Intronic
1149865466 17:60148983-60149005 CTGTGTCCCACATGGGGTGGGGG - Intergenic
1153539642 18:6140036-6140058 GTGTGGCCCAGATGGGTTGGGGG - Intronic
1155589409 18:27409320-27409342 ATGTGAGCCCCATGGGTAGAGGG - Intergenic
1157527465 18:48395309-48395331 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1157527473 18:48395395-48395417 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1157527481 18:48395487-48395509 GTGTGTGTCAGAGGGGTTGGGGG + Intronic
1157538186 18:48476680-48476702 GTGTGACCCACATGGGGTCAAGG - Intergenic
1161421279 19:4177056-4177078 GTGAGTGCCACCTGGGTGCAGGG - Intronic
1163363380 19:16862134-16862156 GTGTGTGACAGATGGGTGGGAGG + Intronic
1163388799 19:17016948-17016970 GTCTGTGGCCCAGGGGTTGAGGG - Intronic
1165332312 19:35147335-35147357 CTGTCTGCCACATGGGGAGAGGG - Intronic
1165352633 19:35284471-35284493 CTGTGTGGCAAATGGATTGAGGG + Intronic
1166801154 19:45458057-45458079 GTGTGTGCCCCCTGGATTGGGGG + Intronic
1168365701 19:55785065-55785087 GTGTGTGTTCCATGGGATGAAGG - Intergenic
924964992 2:67865-67887 GTGTGTGACACATGGGTGAGCGG - Intergenic
924965021 2:68182-68204 GTGTGTGACACATGGGTGAGCGG - Intergenic
926550002 2:14289626-14289648 GTTTGTGCTATATGTGTTGATGG - Intergenic
929578224 2:43066071-43066093 GTGTGTGGCATATGGGAGGATGG - Intergenic
930716636 2:54599574-54599596 CTGTGTCCCACATGCGATGATGG + Intronic
933652277 2:84859040-84859062 GTGTGTGGCTCATGGGCTGTGGG - Intronic
936946282 2:117933953-117933975 GTGGGTGCCAAATGGGTCAATGG - Intronic
937230961 2:120397866-120397888 GTGTTTTCCACGTGGCTTGAGGG - Intergenic
938656367 2:133438186-133438208 GTGTGAGCCACAGGTGTTGTTGG + Intronic
941606652 2:167605535-167605557 GTGGGTTTCACATGGCTTGATGG + Intergenic
944929032 2:204497288-204497310 GTGAGTGCCATATGGGCTGGTGG + Intergenic
947274691 2:228377154-228377176 GTGTGTGCCACTTAGGTGGAAGG + Intergenic
948229325 2:236338095-236338117 GTGGGCGCCAGATGAGTTGAGGG - Intronic
948802271 2:240438316-240438338 GTGGGAGCCACGTGGGCTGAGGG + Intronic
1169355077 20:4898933-4898955 TTGTGTGCCAGGCGGGTTGAGGG + Intronic
1173124432 20:40323664-40323686 GTGTGTGACTCATGTGTGGAGGG + Intergenic
1175706963 20:61186448-61186470 GTCTGTGCCTCCTGGGTTGTTGG + Intergenic
1175946324 20:62560736-62560758 GTGAGTGCAACTGGGGTTGAGGG + Intronic
1179542165 21:42090176-42090198 ATTTGTGCCACGTCGGTTGAGGG - Intronic
1180833354 22:18917565-18917587 GTGTGTACCACAGAGGGTGACGG + Intronic
1180926599 22:19559440-19559462 TTCTGTCTCACATGGGTTGATGG + Intergenic
1181066473 22:20308692-20308714 GTGTGTACCACAGAGGGTGACGG - Intergenic
1183498700 22:38165147-38165169 CTCTGTGCCACCTGGGTGGAGGG - Intronic
1184126894 22:42493515-42493537 GTGTGAGACGCATGGGTGGATGG - Intergenic
1203283440 22_KI270734v1_random:142869-142891 GTGTGTACCACAGAGGGTGACGG + Intergenic
950825879 3:15820596-15820618 GTGTGTGTCAGATGTCTTGAAGG - Intronic
953527350 3:43703704-43703726 GTGAGTGAGACATGGGATGATGG + Intronic
958163779 3:89852717-89852739 GTGTTTACTGCATGGGTTGATGG - Intergenic
960603054 3:119477458-119477480 GGGAGAGCCACATGGGTGGATGG + Intronic
961034090 3:123630128-123630150 GTGTGTGCCCAATGGATAGATGG + Intronic
961918687 3:130403681-130403703 GTGTGTGCAACAGGGGGTGAGGG - Intronic
962082567 3:132156138-132156160 GTGGGTTACACATGGGATGAAGG - Intronic
965907159 3:173723087-173723109 CTGTGTGACACAAGGGTTCATGG + Intronic
967532650 3:190566644-190566666 GTACGTGCCAGATGGGCTGAGGG - Intronic
969636254 4:8370862-8370884 GGGAGTGCCCCAAGGGTTGATGG - Intronic
970592382 4:17570712-17570734 GGTTTTGCCACATGGGATGATGG + Intergenic
974291663 4:59940417-59940439 ATGTTTGAGACATGGGTTGATGG - Intergenic
975867138 4:78735678-78735700 GCTTGTGTCACCTGGGTTGAGGG - Intergenic
984431370 4:179653589-179653611 GTGTGTGCCACATATGGTGCTGG - Intergenic
985599323 5:818267-818289 CTGTGTGCCACATGGAGTGAGGG + Intronic
986331818 5:6722103-6722125 GAGTGTGTGACATGGGCTGATGG - Intronic
988484107 5:31654224-31654246 GTGTGTGTCAAATGCTTTGAGGG - Intronic
990503378 5:56420016-56420038 GTGTCTGGCACATAGGTAGAAGG - Intergenic
994806615 5:104456351-104456373 GTGTGTGGGAAATGAGTTGATGG - Intergenic
994957872 5:106557989-106558011 GTGTGTGTGTCAAGGGTTGAAGG - Intergenic
996532284 5:124538783-124538805 GTGAGTGCCACATGAATTCAAGG - Intergenic
998912221 5:146972323-146972345 GTGTTTGCCAGATGTGTTCATGG + Intronic
1000707663 5:164531341-164531363 TTGTGTGCCACAAGTGTAGAAGG - Intergenic
1002566918 5:180117270-180117292 GTGTCTGCCCCTTGGGTGGAGGG + Intronic
1006108545 6:31730546-31730568 GTGTGGGCGACATGGAATGAGGG - Intronic
1006298117 6:33179050-33179072 GTGAGTGCCCCAGGGGTGGATGG - Intronic
1007070668 6:39035893-39035915 GGATGTGCCGCATGGGGTGAGGG + Intergenic
1008550056 6:52620347-52620369 GAGTGTGCCTGATGGGTTGCAGG - Intergenic
1011080372 6:83484152-83484174 GTGTGTGGCCCATGGGCTGTGGG + Intergenic
1015494991 6:133871486-133871508 CTGTGTGCCAGATGGGTTGAGGG - Intergenic
1017368200 6:153670033-153670055 GTTTGTGCCACGTGGGCAGAGGG + Intergenic
1019425066 7:971085-971107 GTGGGGGCCTCATGGGATGATGG - Intronic
1020173120 7:5861050-5861072 GTGTGTGCCACAGGTGGTGGTGG + Intergenic
1025144660 7:56493194-56493216 GTGTGTGCCACCTGGGGTATGGG + Intergenic
1027141682 7:75662054-75662076 GAGTGAGCCACAAGGGGTGAAGG + Intronic
1027442048 7:78229757-78229779 GTGTCTCCCACTTGGGTTGGAGG - Intronic
1029085627 7:98009480-98009502 GTGTGTGCCACAGGTGGTGGTGG - Intergenic
1031731465 7:125306897-125306919 GTGTGTAGCTCAGGGGTTGAGGG + Intergenic
1034190145 7:149207559-149207581 GTGTGTGCACCATGGGGCGAGGG + Intronic
1034992826 7:155558980-155559002 GTTTCTGCCTCTTGGGTTGATGG - Intergenic
1037363311 8:18096480-18096502 GGGTGTGCCACATGGGTATCTGG - Intergenic
1037576217 8:20206308-20206330 GTGTGTACCCCATAGGTTAAGGG + Intronic
1038230933 8:25699278-25699300 GTGTGTCCAACATGGGTGGTAGG - Intergenic
1039789830 8:40866416-40866438 ATGTGTGCCACATTGTTTGTTGG - Intronic
1040483684 8:47850751-47850773 CTGTGTGCCACAGGTGCTGAGGG + Intronic
1043993941 8:86789933-86789955 ATGTGTGCCAGATGGCCTGATGG + Intergenic
1044299431 8:90566713-90566735 GTGTGAGCAACATGGGAAGAAGG - Intergenic
1044299602 8:90568192-90568214 GTGTGAGCAACATGGGAAGAAGG - Intergenic
1046458325 8:114499154-114499176 TTATGAGCCACATGGGTTAAAGG + Intergenic
1049601095 8:143508037-143508059 GTGTGTGCCACATGGGTTGAGGG - Intronic
1050105140 9:2157656-2157678 GACTGTGCCACATGGCTTGGTGG + Intronic
1056290771 9:85141621-85141643 GTCTTTGCCACATGCCTTGATGG - Intergenic
1056495765 9:87153773-87153795 GTGTCTACCTCATGGGTTCATGG - Intronic
1057730225 9:97602102-97602124 GTGTTTGCCACCAGGGTAGAAGG + Exonic
1059525206 9:114984903-114984925 TTGTGGGCATCATGGGTTGAGGG - Intergenic
1061419854 9:130467138-130467160 GTGTGTGTCACTTGGGGGGATGG + Intronic
1186541806 X:10408868-10408890 GTCTGTGCCTTATGAGTTGAGGG + Intergenic
1187248477 X:17575174-17575196 GTGTGTGACCCATGAGTTAAAGG - Intronic
1189291139 X:39886891-39886913 CTGTGTGCCAGATGTGTTGCTGG - Intergenic
1190873495 X:54444190-54444212 GTGGGTGCCCCCTGGGTTGGGGG + Intronic
1193305842 X:79950065-79950087 GAGTTTGCCTCATGGTTTGAGGG + Intergenic
1194858372 X:98962501-98962523 GTGTGTGCATCATGGGATGATGG + Intergenic
1196768633 X:119272130-119272152 CTGTGCTCCACAAGGGTTGAAGG + Intergenic
1198639071 X:138736134-138736156 GTGAGTGCCTCCTGGGTAGAAGG - Intronic