ID: 1049601664

View in Genome Browser
Species Human (GRCh38)
Location 8:143510594-143510616
Sequence CGCTGCACACCCTGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049601664_1049601675 5 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601675 8:143510622-143510644 GTGGGCAGGTGGCAAGGCTTGGG No data
1049601664_1049601677 15 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601677 8:143510632-143510654 GGCAAGGCTTGGGAGGCTGCAGG No data
1049601664_1049601673 -1 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601673 8:143510616-143510638 GATGGCGTGGGCAGGTGGCAAGG No data
1049601664_1049601672 -6 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601672 8:143510611-143510633 GCAGCGATGGCGTGGGCAGGTGG No data
1049601664_1049601676 8 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601676 8:143510625-143510647 GGCAGGTGGCAAGGCTTGGGAGG No data
1049601664_1049601671 -9 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601671 8:143510608-143510630 TGTGCAGCGATGGCGTGGGCAGG No data
1049601664_1049601674 4 Left 1049601664 8:143510594-143510616 CCTGTTCCCCAGGGTGTGCAGCG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 1049601674 8:143510621-143510643 CGTGGGCAGGTGGCAAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049601664 Original CRISPR CGCTGCACACCCTGGGGAAC AGG (reversed) Intronic
900116907 1:1032943-1032965 CGCTGCCCAGCCGGGGGATCCGG - Intronic
900178628 1:1301870-1301892 CGCTGCACAGCCTGGAGGCCTGG + Intronic
900920203 1:5665281-5665303 CGCAGGACAGCCTGGGGATCTGG + Intergenic
902173229 1:14629838-14629860 AGCTGCACACCCTGGGGCTAGGG + Intronic
903341210 1:22655657-22655679 CTCTCAACACCCTGGGGAAGTGG - Intronic
904265810 1:29318025-29318047 CCCTGCCCATTCTGGGGAACAGG + Intronic
904947961 1:34213157-34213179 CCGGGCACACCCTGGGGAATGGG + Intronic
906662529 1:47593223-47593245 CGCTGCAGACCCTGCGGAGACGG - Intergenic
910898248 1:92091345-92091367 TCCTGTACAGCCTGGGGAACTGG + Intronic
912435975 1:109661298-109661320 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912437917 1:109674880-109674902 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912440428 1:109693339-109693361 CGCTGCACAGCCTGGGCAGCAGG - Exonic
912777824 1:112517109-112517131 CGCCGCACAGCCTGGGGGAGGGG - Exonic
913452181 1:118999921-118999943 CGCTGCGCACCCTGCCAAACTGG - Intergenic
917379787 1:174393126-174393148 CGCTGCACACCTTTGGGATGTGG + Intronic
921984597 1:221298663-221298685 GGCAACACACTCTGGGGAACAGG - Intergenic
924554860 1:245109505-245109527 CGATGCACACCCAGGCGTACCGG - Intronic
1063178163 10:3570847-3570869 CCCTGCACAGCCTTGGGGACAGG + Intergenic
1063451320 10:6152212-6152234 CACTGCAGAGCCTGGGGAGCCGG + Intronic
1063515998 10:6696024-6696046 CGCTGCACAACTTGGTAAACAGG + Intergenic
1063663933 10:8050894-8050916 CGCTGCCCGACCTGGGTAACAGG - Intergenic
1064037449 10:11926263-11926285 CACTGGAGACCCTGGGGAAGAGG + Intronic
1066659899 10:37728641-37728663 GGCTGCACACCTTGGGGAACAGG - Intergenic
1066962812 10:42236293-42236315 GGCTGCACTCCTTGGGGAACAGG + Intergenic
1067474511 10:46556873-46556895 CGCTGGGCAGCCTGGAGAACAGG - Intergenic
1069917404 10:71796008-71796030 CGCTCCCCAGCCTGGGGGACAGG + Exonic
1070655853 10:78270725-78270747 CACAGCACACACTGGGGAACAGG - Intergenic
1071724035 10:88178116-88178138 CACCCTACACCCTGGGGAACAGG - Intergenic
1074003179 10:109392778-109392800 CACTGCACAACCTGGACAACAGG + Intergenic
1074905660 10:117861370-117861392 CCCTGCACACCATGGGAAAAAGG - Intergenic
1076697897 10:132255933-132255955 CTCTGCACACCCTGGAGCCCTGG + Intronic
1083771296 11:64869193-64869215 CAGTGCGCAGCCTGGGGAACAGG + Intronic
1088159739 11:106854903-106854925 TGCACTACACCCTGGGGAACAGG - Intronic
1090874690 11:130778249-130778271 CCCTGCACGCCATGGGGCACAGG + Intergenic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091750432 12:3018664-3018686 CCCAGCACACCCTGGGGCCCAGG - Intronic
1094160102 12:27381362-27381384 TCCTGCACAGCCTGTGGAACCGG - Intronic
1098218643 12:68245589-68245611 CACTGCACAGCCTGTGGAGCAGG + Intergenic
1098917747 12:76274858-76274880 TCCTGCACGCCCTGGGTAACAGG + Intergenic
1101249444 12:102917415-102917437 CGCTGCCCGCCCTGGGTAAAGGG + Exonic
1102261876 12:111447888-111447910 TGCTGCAGACCCAGGGGTACAGG + Intronic
1102350090 12:112185393-112185415 CGGTGCACACCCTGGAGCAGAGG - Exonic
1102458766 12:113087401-113087423 CGCTGCAAGCCCGGGGGACCAGG - Intronic
1102500150 12:113346554-113346576 TGCAGCACACCCTGGGTGACTGG + Intronic
1106221696 13:27751332-27751354 CCCTGCTCACCCTTGGGAAGTGG + Intergenic
1107508935 13:41061861-41061883 CGCTGAACGCCCTGGGGTATGGG + Intronic
1112050558 13:95641448-95641470 AGCTGCACACCCTGGAGGAGCGG - Exonic
1113983002 13:114292011-114292033 CACTGCACACCCAGGAGGACAGG - Intronic
1115590458 14:34859393-34859415 CACTGCACAGTCTGGGCAACAGG + Intronic
1119250433 14:73148336-73148358 CGCTGCACACCTTGGGAAGCTGG - Intronic
1119464300 14:74842677-74842699 TGCTGTCCACCCTGGGCAACAGG + Intronic
1119666204 14:76486787-76486809 CCCTGCACTCCCAGGGGCACGGG + Intronic
1119805650 14:77480389-77480411 CCCTGCACACCCTGAGGATTTGG - Intronic
1121729090 14:96173903-96173925 CGCTGCAGGCCCAGGGGAGCTGG + Intergenic
1202929550 14_KI270725v1_random:26046-26068 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1123422751 15:20145177-20145199 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1123531975 15:21151717-21151739 GGCTGCACTCCTTGGGGAGCAGG + Intergenic
1124215595 15:27805434-27805456 GGCTGCACACCGCGGGGACCCGG + Intronic
1125381703 15:39092908-39092930 TGCTGCCTACCCTGGGGAGCAGG + Intergenic
1126841950 15:52725778-52725800 CCCTGCAGACTCTTGGGAACAGG - Intergenic
1130048943 15:80467537-80467559 CGCCAGACACCCTGGAGAACCGG - Intronic
1131467518 15:92667645-92667667 GGCTCCACACTGTGGGGAACAGG - Intronic
1132585359 16:703813-703835 AGCTGGACACCCTGGGGAGTGGG + Intronic
1132703587 16:1231822-1231844 GGCTGCACCCCCCGGGGGACAGG + Intergenic
1132704922 16:1239539-1239561 GGCTGCACCCCCCGGGGGACAGG - Intergenic
1132707931 16:1254573-1254595 GGCTGCACCCCCCGGGGGACAGG - Intergenic
1132977994 16:2720042-2720064 CGCTGCACTGCCTGGGGCTCCGG - Intronic
1138344544 16:56311945-56311967 TGGTGCCCACCCAGGGGAACCGG - Intronic
1139371085 16:66469872-66469894 CGCCGCCCACCCTGGGGCCCTGG + Exonic
1142122436 16:88393526-88393548 CTCTGCCCACCCTGGGCCACAGG - Intergenic
1142298456 16:89242417-89242439 CCCAGCAAACCCTGGGGAATGGG + Intergenic
1143493148 17:7295127-7295149 CCCTGCACACCCTGGGGCTGCGG + Intergenic
1143848153 17:9788696-9788718 CGCTGCACACCCTGGTGCCACGG - Intronic
1144952889 17:19003682-19003704 CGCTGCCCTCCCTGGAGTACTGG - Exonic
1146662666 17:34674971-34674993 CCCTGCTCACCCTGGGGACCTGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147038968 17:37702460-37702482 CGCTGAGCCCCCTGGGGAACTGG - Intronic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151316164 17:73323999-73324021 CTCTGCACAACCTGGGGCAGAGG - Intergenic
1151983767 17:77529069-77529091 CGCTGCAGTCCCTGGGAAATGGG + Intergenic
1152162734 17:78679127-78679149 TATTGCACACCCTCGGGAACGGG + Intronic
1152640995 17:81449203-81449225 TTCTGCACACCCTGGGGATTGGG - Intronic
1152685903 17:81693789-81693811 CGCAGCACATCCAGGGGAGCTGG - Intronic
1153979283 18:10295559-10295581 GCCTGCACAGCCTGGGGACCAGG - Intergenic
1155228926 18:23755279-23755301 CCCTGGAGACCCTGGAGAACTGG + Intronic
1157273533 18:46294387-46294409 GCCTGCACACCTTGGGGATCAGG - Intergenic
1157743586 18:50115176-50115198 GGCTGCCCACCTTGGGGATCAGG - Intronic
1159496901 18:69218915-69218937 CGCTACACACTCAGGGGATCAGG + Intergenic
1160802016 19:974587-974609 TGCTGCAGACCCTGGTGCACGGG - Exonic
1160944265 19:1633943-1633965 CTCTGCACCTCCTGGGGTACTGG - Intronic
1161219299 19:3110695-3110717 GGCTGCTCAGCCTGGGGAAGGGG - Intronic
1161610272 19:5238376-5238398 CCCTCCCCACCCTCGGGAACTGG + Intronic
1163681430 19:18684517-18684539 CTCTGGACCCCCTGGGGGACAGG - Intronic
1163687345 19:18719328-18719350 TGCTGCAGGCCCTGGGGACCCGG - Intronic
1165942497 19:39422171-39422193 CTCTGCACCCCCTGAGGACCTGG + Exonic
1167419317 19:49393997-49394019 CCCAGCCCACCCTGGGGACCAGG - Intronic
1168393303 19:56028199-56028221 TGCTTCACCCCCAGGGGAACGGG - Exonic
1168423063 19:56217722-56217744 CGCTGCAGTCCTTGGGGAAGCGG + Intergenic
926207722 2:10845939-10845961 CCCTGCACACCCTGGGAGCCAGG + Intergenic
926740265 2:16104769-16104791 AGCTGCAGACCCCGGAGAACTGG - Intergenic
927210937 2:20638627-20638649 CCCTGCAGCCCCTGGGGATCTGG + Exonic
932414079 2:71563439-71563461 AGCTGCACACTCTGGAGAGCAGG - Intronic
934460443 2:94211606-94211628 GGCTGCACTCCTCGGGGAACAGG - Intergenic
935829707 2:106988255-106988277 CACAGCAAACCCTGGGGTACTGG + Intergenic
936111768 2:109670879-109670901 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
936983194 2:118283391-118283413 GGCAGGACACCCTGGGGAAGAGG + Intergenic
938287126 2:130128085-130128107 GGCTGCACTCCTTGGGGAGCAGG + Intronic
938428467 2:131210785-131210807 GGCTGCACTCCTTGGGGAGCAGG - Intronic
938469369 2:131544803-131544825 GGCTGCACTCCTTGGGGAGCAGG - Intergenic
940254494 2:151714493-151714515 TTCTGCACCCCCTGGGGAGCTGG + Intronic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945430207 2:209755100-209755122 GGGTGCAGACCCTGGGGAAGGGG + Intergenic
947712881 2:232325961-232325983 CGCTCCACACTCTGGGCCACGGG - Intronic
947732565 2:232439403-232439425 CGCTCCACACTCTGGGCCACGGG - Intergenic
948427032 2:237894869-237894891 CGTTGCCAGCCCTGGGGAACAGG + Intronic
948722678 2:239911390-239911412 CTCTGCAAACCCTGGGGGACTGG + Intronic
948894802 2:240923094-240923116 GGCTGCTCACCATGGGGGACGGG + Intronic
1174111568 20:48201269-48201291 TGCTCCTCACCCTGGGGATCTGG + Intergenic
1175487007 20:59353857-59353879 AGCTTGACAGCCTGGGGAACAGG + Intergenic
1175691933 20:61071787-61071809 CGCTGCTCTGTCTGGGGAACAGG - Intergenic
1176104348 20:63378848-63378870 AGCTGCTCATCCTGGGGAGCAGG - Intergenic
1176591576 21:8654645-8654667 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1178695825 21:34792314-34792336 CGCCGCCCACCATGGAGAACTGG + Exonic
1178886545 21:36489485-36489507 CACAGCACACCCTGGAGAAGAGG - Intronic
1180274423 22:10631757-10631779 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1181496362 22:23289420-23289442 CACCACACACCCTGGGGAAGGGG - Intronic
1181590578 22:23882662-23882684 CGCCGCACACCCTGGGCCCCGGG + Intronic
1182321433 22:29480489-29480511 CGCTGGACACGCTGAGCAACGGG + Exonic
1184095188 22:42312604-42312626 CACTCCACACCCTGGGGAATGGG - Intronic
1184770652 22:46594780-46594802 CCCTGCAAACCCTGGGGGAGGGG + Intronic
1184947835 22:47816784-47816806 CTCTGCAAACCCTTGGGACCCGG - Intergenic
949896118 3:8768562-8768584 CGCTGAACATCCCGAGGAACTGG - Exonic
950487148 3:13280624-13280646 CACTGCTCACCCTGGGGTCCGGG + Intergenic
951558666 3:23945416-23945438 CGCTGCACGGCCTGGGGCCCGGG + Exonic
952402131 3:32972918-32972940 AGCTGCACAGCCAGGGAAACAGG - Intergenic
954221062 3:49154230-49154252 AACTGCACACCCTGGGTGACAGG - Intergenic
955407619 3:58635506-58635528 GGCTCCAGACCCAGGGGAACCGG - Intronic
961045182 3:123703240-123703262 CGCTGCTCACCCTTGGGTGCTGG + Intronic
963529731 3:146460027-146460049 GGCTGGACACACTGGGAAACAGG - Exonic
966378644 3:179322737-179322759 CCCTTCAAGCCCTGGGGAACTGG - Intergenic
966875664 3:184320326-184320348 GGCTGCACACCCTGGGGCCCAGG - Intronic
968520656 4:1033382-1033404 CCCTCAGCACCCTGGGGAACAGG + Intergenic
969327839 4:6453937-6453959 CGGTGCACACCCAGGGCCACCGG + Intronic
970500930 4:16676443-16676465 CACGGAACACCCTGGGGATCTGG + Intronic
974385976 4:61202056-61202078 AGCTGCACACGCTGGGGAATAGG + Intronic
975794718 4:77994991-77995013 CCCTGGAAAGCCTGGGGAACTGG + Intergenic
975848923 4:78551946-78551968 AGCTGCACTCGCGGGGGAACTGG - Intronic
979764252 4:124445685-124445707 AGTCCCACACCCTGGGGAACAGG - Intergenic
982158152 4:152540961-152540983 CTCTGCACCCTCTGGGGGACGGG - Intergenic
987132633 5:14872476-14872498 CCCTGGAAACCCTGGGGGACAGG - Intergenic
988110036 5:26807886-26807908 CACTGCAGGCACTGGGGAACAGG - Intergenic
990960170 5:61385762-61385784 TTATGCACACCCTGGGGCACAGG - Intronic
992530216 5:77645658-77645680 CGCTGCGCCCCCTGGGGGCCGGG - Intergenic
997472443 5:134124425-134124447 CCCTCTACTCCCTGGGGAACTGG - Intronic
1000266968 5:159647224-159647246 GGCTACACAGGCTGGGGAACGGG - Intergenic
1001561260 5:172670343-172670365 CGCGGCGCCCCCTGGGGACCTGG + Intronic
1001762082 5:174215832-174215854 CGCTGCACATGCTGGGGCAGAGG - Intronic
1001904506 5:175460719-175460741 AGGTCCCCACCCTGGGGAACTGG + Intergenic
1003949429 6:11104260-11104282 CCCTCCTCACCCTGGGCAACGGG + Exonic
1009935961 6:70234837-70234859 CCCTGCACACCCCGGGGTCCAGG + Exonic
1013533989 6:111046802-111046824 CTCTCCACAGCCTGGGCAACAGG + Intergenic
1018476812 6:164150713-164150735 CCCTCCACACCCTGGTGGACAGG - Intergenic
1018501078 6:164411634-164411656 CGCTGCATACCCTGAGAAACGGG - Intergenic
1019696752 7:2450590-2450612 CCCCCCACTCCCTGGGGAACAGG + Intergenic
1024094554 7:45973472-45973494 CCCTGTACACCCTGGGGGAGTGG + Intergenic
1024653181 7:51426149-51426171 CGCAGCACGCCCTGGGAAGCAGG - Intergenic
1032026259 7:128444942-128444964 CACTGCCCAGCCTGGGGCACTGG - Intergenic
1032607718 7:133374879-133374901 CGCTGCACACTCTGTGGTCCTGG + Exonic
1033313836 7:140281940-140281962 GGCTGCACACACTGGAGTACTGG - Intergenic
1034445371 7:151111311-151111333 TGCTCCACACCCTGCGGAGCTGG + Intronic
1034699474 7:153083838-153083860 CCCTGCACAGCCTGCAGAACTGG - Intergenic
1036023122 8:4871015-4871037 CTGTGCTCACCCTGGGGAGCTGG + Intronic
1040584059 8:48723669-48723691 CACAGCACATACTGGGGAACTGG + Exonic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1049391659 8:142374831-142374853 CTCAGCTCAGCCTGGGGAACAGG + Intronic
1049601664 8:143510594-143510616 CGCTGCACACCCTGGGGAACAGG - Intronic
1052990128 9:34514217-34514239 CTCAGCACACCCTGGGGGAAAGG - Intronic
1053239826 9:36487079-36487101 CCCTGCACACCCTGGGGGAGGGG + Intronic
1053593176 9:39533849-39533871 TGCTGCAGACCCTGGTGCACGGG + Intergenic
1053690940 9:40587303-40587325 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1053850910 9:42288557-42288579 TGCTGCAGACCCTGGTGCACGGG + Intergenic
1054273864 9:63050188-63050210 GGCTGCACTCCTCGGGGAACAGG + Intergenic
1054302200 9:63388274-63388296 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1054400976 9:64714780-64714802 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1054434583 9:65199094-65199116 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1054495807 9:65822587-65822609 GGCTGCACTCCTCGGGGAACAGG + Intergenic
1054573131 9:66831428-66831450 TGCTGCAGACCCTGGTGCACGGG - Intergenic
1058935082 9:109762849-109762871 CCCTCCACCCCCTGGGGAATGGG - Intronic
1060980466 9:127788702-127788724 CTCTGCACCCCGTGGGGACCGGG - Intronic
1062099874 9:134722464-134722486 TGCTGGACACCCTGGGGTACGGG + Intronic
1062618702 9:137409709-137409731 CGCTGCACACTCTCTGTAACTGG + Intronic
1203621599 Un_KI270749v1:133409-133431 GGCTGCACTCCTCGGGGAACAGG - Intergenic
1187891898 X:23944113-23944135 CATTGCACAGCCTGGGCAACAGG + Intergenic
1198223082 X:134621008-134621030 CCCTTCACACCCAAGGGAACTGG + Intronic
1199063507 X:143387749-143387771 CCCTGTACAGCCTGTGGAACTGG + Intergenic
1201189642 Y:11436000-11436022 GGCTGCACTCCTTGGGGAGCAGG - Intergenic