ID: 1049602524

View in Genome Browser
Species Human (GRCh38)
Location 8:143514502-143514524
Sequence ACTGACATGCACACGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049602518_1049602524 18 Left 1049602518 8:143514461-143514483 CCTGCCAGGACACACAAGTGCAC 0: 1
1: 0
2: 1
3: 16
4: 209
Right 1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG No data
1049602519_1049602524 14 Left 1049602519 8:143514465-143514487 CCAGGACACACAAGTGCACTCAG 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1049602524 8:143514502-143514524 ACTGACATGCACACGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049602524 Original CRISPR ACTGACATGCACACGGTGGG CGG Intronic
No off target data available for this crispr