ID: 1049602524 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143514502-143514524 |
Sequence | ACTGACATGCACACGGTGGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049602518_1049602524 | 18 | Left | 1049602518 | 8:143514461-143514483 | CCTGCCAGGACACACAAGTGCAC | 0: 1 1: 0 2: 1 3: 16 4: 209 |
||
Right | 1049602524 | 8:143514502-143514524 | ACTGACATGCACACGGTGGGCGG | No data | ||||
1049602519_1049602524 | 14 | Left | 1049602519 | 8:143514465-143514487 | CCAGGACACACAAGTGCACTCAG | 0: 1 1: 0 2: 0 3: 12 4: 200 |
||
Right | 1049602524 | 8:143514502-143514524 | ACTGACATGCACACGGTGGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049602524 | Original CRISPR | ACTGACATGCACACGGTGGG CGG | Intronic | ||
No off target data available for this crispr |