ID: 1049603692

View in Genome Browser
Species Human (GRCh38)
Location 8:143519519-143519541
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049603683_1049603692 3 Left 1049603683 8:143519493-143519515 CCCCAGGCCTGAGCACCCCACAT 0: 1
1: 0
2: 4
3: 30
4: 315
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data
1049603680_1049603692 20 Left 1049603680 8:143519476-143519498 CCTTGCATTCCTCGTTACCCCAG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data
1049603685_1049603692 1 Left 1049603685 8:143519495-143519517 CCAGGCCTGAGCACCCCACATCA 0: 1
1: 0
2: 4
3: 22
4: 344
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data
1049603682_1049603692 11 Left 1049603682 8:143519485-143519507 CCTCGTTACCCCAGGCCTGAGCA 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data
1049603684_1049603692 2 Left 1049603684 8:143519494-143519516 CCCAGGCCTGAGCACCCCACATC 0: 1
1: 0
2: 6
3: 24
4: 260
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data
1049603686_1049603692 -4 Left 1049603686 8:143519500-143519522 CCTGAGCACCCCACATCACAGCC 0: 1
1: 0
2: 0
3: 20
4: 328
Right 1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr