ID: 1049610168

View in Genome Browser
Species Human (GRCh38)
Location 8:143551432-143551454
Sequence TTGGATGCAGTACAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049610161_1049610168 22 Left 1049610161 8:143551387-143551409 CCAGCCCCTCCTCACTATCTGAT No data
Right 1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG No data
1049610163_1049610168 17 Left 1049610163 8:143551392-143551414 CCCTCCTCACTATCTGATTGTCA No data
Right 1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG No data
1049610164_1049610168 16 Left 1049610164 8:143551393-143551415 CCTCCTCACTATCTGATTGTCAA No data
Right 1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG No data
1049610162_1049610168 18 Left 1049610162 8:143551391-143551413 CCCCTCCTCACTATCTGATTGTC No data
Right 1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG No data
1049610165_1049610168 13 Left 1049610165 8:143551396-143551418 CCTCACTATCTGATTGTCAACAT No data
Right 1049610168 8:143551432-143551454 TTGGATGCAGTACAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049610168 Original CRISPR TTGGATGCAGTACAAGAGCA TGG Intergenic
No off target data available for this crispr