ID: 1049610430

View in Genome Browser
Species Human (GRCh38)
Location 8:143552653-143552675
Sequence AGAGCCCTGCTAAGGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049610430_1049610436 5 Left 1049610430 8:143552653-143552675 CCCCCTGGCCTTAGCAGGGCTCT No data
Right 1049610436 8:143552681-143552703 CACCTGCCTCTCCTCACTCTTGG No data
1049610430_1049610439 7 Left 1049610430 8:143552653-143552675 CCCCCTGGCCTTAGCAGGGCTCT No data
Right 1049610439 8:143552683-143552705 CCTGCCTCTCCTCACTCTTGGGG No data
1049610430_1049610437 6 Left 1049610430 8:143552653-143552675 CCCCCTGGCCTTAGCAGGGCTCT No data
Right 1049610437 8:143552682-143552704 ACCTGCCTCTCCTCACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049610430 Original CRISPR AGAGCCCTGCTAAGGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr