ID: 1049610597

View in Genome Browser
Species Human (GRCh38)
Location 8:143553129-143553151
Sequence CCTGAAGTCCCGCCCTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049610592_1049610597 4 Left 1049610592 8:143553102-143553124 CCAGGCCAGGACAGTGTCTGGCA 0: 1
1: 0
2: 5
3: 56
4: 337
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610589_1049610597 19 Left 1049610589 8:143553087-143553109 CCTCGGGAGCTGCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 33
4: 331
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610587_1049610597 21 Left 1049610587 8:143553085-143553107 CCCCTCGGGAGCTGCTGCCAGGC 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610583_1049610597 28 Left 1049610583 8:143553078-143553100 CCCAGACCCCCTCGGGAGCTGCT 0: 1
1: 0
2: 4
3: 13
4: 178
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610588_1049610597 20 Left 1049610588 8:143553086-143553108 CCCTCGGGAGCTGCTGCCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610582_1049610597 29 Left 1049610582 8:143553077-143553099 CCCCAGACCCCCTCGGGAGCTGC 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610585_1049610597 22 Left 1049610585 8:143553084-143553106 CCCCCTCGGGAGCTGCTGCCAGG 0: 1
1: 1
2: 1
3: 28
4: 294
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610594_1049610597 -1 Left 1049610594 8:143553107-143553129 CCAGGACAGTGTCTGGCAGGCAC 0: 1
1: 0
2: 5
3: 37
4: 326
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129
1049610584_1049610597 27 Left 1049610584 8:143553079-143553101 CCAGACCCCCTCGGGAGCTGCTG 0: 1
1: 0
2: 1
3: 22
4: 227
Right 1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG 0: 1
1: 1
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049610597 Original CRISPR CCTGAAGTCCCGCCCTGCGC GGG Intergenic
901301253 1:8201443-8201465 CCTGTGGTCCTGCCCTGCCCAGG + Intergenic
903438415 1:23369275-23369297 CCTGAAGGCCCGCCCGGATCAGG - Exonic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
905199432 1:36306342-36306364 CCTCAGGTCGCACCCTGCGCGGG + Intergenic
905303906 1:37004600-37004622 CCTGATGTCCCTCCCTGCCATGG - Intronic
919739201 1:200972323-200972345 CCTGCAGTCCCCCACTGGGCCGG - Intronic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
922718247 1:227887762-227887784 CCCGAAGTCGAGCCCTGGGCAGG + Intergenic
922724092 1:227914562-227914584 CCTCCAGTCTGGCCCTGCGCAGG + Intergenic
1062847249 10:717654-717676 CCTGATTTCCCACCCTGAGCAGG + Intergenic
1062888387 10:1036803-1036825 CATGAAGACACGCCCTGCGTGGG - Intergenic
1064264929 10:13818285-13818307 CCTGTAGTCCCCCCCTACTCAGG - Intronic
1073449891 10:103603045-103603067 CCTGAAGCCCCGCTCTGCTTCGG - Exonic
1076726591 10:132416812-132416834 CCTGAAGTCCCGCAGTCCACAGG - Intronic
1077406965 11:2387005-2387027 CCTGAAGTCCCACCATTAGCAGG + Intronic
1077474864 11:2781543-2781565 CCTGAAGTCCCACACAGGGCTGG + Intronic
1077524766 11:3057434-3057456 CCGGAAGTCGCGCCCCACGCCGG + Exonic
1078476223 11:11632682-11632704 CCCGAAATCCTGCCCTGGGCTGG + Intergenic
1079130784 11:17745722-17745744 CCTCAAGACCTGCGCTGCGCTGG + Intronic
1083479270 11:62933426-62933448 CCTGATGCCCCGCCCTTCCCTGG - Intergenic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1083758382 11:64803153-64803175 CCTGCCGGCCCGCCCGGCGCCGG - Exonic
1085439259 11:76543466-76543488 CCTGGAGTCCGGCCCTCAGCTGG + Intronic
1094630923 12:32173012-32173034 CCCGGAGTCCCGCCCTGTTCAGG + Intronic
1096173332 12:49492342-49492364 CCTGTAGTCCCGCCCTACGTAGG - Intronic
1101732286 12:107436714-107436736 GCAGAAGTCCCACCATGCGCTGG - Intronic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1103960001 12:124603468-124603490 GCTGCAGTCCCTCCCTGCCCTGG - Intergenic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1107889904 13:44905213-44905235 GCTGGAGTCCTGCCCTGAGCTGG - Intergenic
1108386475 13:49903908-49903930 CCTGTAGTCCCAGCCTGCTCTGG - Intergenic
1113707215 13:112442685-112442707 CCTGCAGTCCCTCCCTGCACGGG + Intergenic
1116862664 14:50007136-50007158 CCTCAAGCCCCACCCTGAGCAGG + Exonic
1117072460 14:52069097-52069119 CCTGGAGTCCCGCCCCGCCCAGG - Intronic
1122655751 14:103258353-103258375 CCTGGATTCCGGCCCTGAGCTGG - Intergenic
1124600593 15:31129992-31130014 GCTGAAGACCAGCCCTGCCCAGG - Intronic
1129245892 15:74278473-74278495 CCCGCAGCCCCGCCCTGTGCTGG + Intronic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1130068454 15:80626635-80626657 ACTGAAATCCTGCCCTGTGCAGG + Intergenic
1131686014 15:94768416-94768438 CCTGAACTCCCCCCCTGCACGGG - Intergenic
1138547355 16:57727766-57727788 CCTGAATGCCCTCCCTGTGCTGG - Intronic
1139475238 16:67199615-67199637 CCTGCCCTCCCGCCCTCCGCAGG - Intronic
1139545649 16:67648395-67648417 CAGGAAGTCCCGCGCCGCGCCGG + Exonic
1142074383 16:88108880-88108902 TCTGAAGTCCCGACCGGGGCTGG - Intronic
1144909249 17:18667389-18667411 CCTGAAATCACACCCTGAGCGGG + Intronic
1146159494 17:30552351-30552373 CCTTAAGTCCAGCCCAGCACAGG - Intergenic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1151573056 17:74936634-74936656 CCTGAAGTCCAGCCCTCCAAAGG - Intronic
1151657257 17:75501871-75501893 CCTCCAGTGCCGCCCTGCCCAGG - Exonic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1157766100 18:50298617-50298639 CCAGAAGTCGGGCCCTGCGTGGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161065892 19:2237063-2237085 CCTGAGGCCCCGCGCTGGGCGGG + Intronic
1161065895 19:2237071-2237093 CCTCCAGGCCCGCCCAGCGCGGG - Intronic
1161084687 19:2329270-2329292 CCAGGAGTCCAGCCCTGCACTGG + Intronic
1161318939 19:3632254-3632276 CCTGACCTTCCGCCCTGAGCTGG + Exonic
1161392607 19:4029080-4029102 CCTGGAAACCCGCCCTGTGCTGG + Intronic
1161471293 19:4457836-4457858 CCGGAAGTCCCGCCTTCCCCTGG + Intergenic
1161550697 19:4910451-4910473 TCTGAAGTTCCGGCCCGCGCTGG + Intronic
1161571161 19:5031569-5031591 CCTGACGTCACACCCCGCGCTGG - Intronic
1163698954 19:18777633-18777655 CCTGCAGACCCTCCCTGCACTGG + Exonic
1164678867 19:30120939-30120961 CCTGCACTCCCGCCCTCCTCAGG + Intergenic
1164812075 19:31165136-31165158 ACTGAAGTGCAGCCCTGCCCCGG + Intergenic
1165091665 19:33391213-33391235 CCTAGAGTCCCACCCTGCCCTGG + Intronic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1166081075 19:40444387-40444409 GCTGGAGTCCCGCCCGCCGCGGG + Exonic
1168561675 19:57389842-57389864 GCGGAAGTCCCGCCCTCCGACGG - Intronic
1168590815 19:57633161-57633183 CCACAAGTCCCGCCCTGGGGGGG - Intronic
1168696818 19:58408502-58408524 CCGGAAGCCCCGCCCCACGCAGG + Intronic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
929286757 2:40143814-40143836 CCTGAATTCAAGCCCTGAGCAGG - Intronic
934519483 2:95010868-95010890 CCAGCAGTCCAGCCCAGCGCAGG + Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
948180154 2:235973165-235973187 CCTGGAGTTTCTCCCTGCGCAGG + Intronic
948632685 2:239312189-239312211 CCTGGTGTCCTGCCCTGCCCAGG - Intronic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
1173868566 20:46328369-46328391 CCTGCCGGCCCGCCCTGGGCTGG + Intergenic
1174773847 20:53325525-53325547 ACTGAAGTCCCGCCCAGGGGAGG - Intronic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1175893446 20:62325402-62325424 CCTCCAGTGCCACCCTGCGCAGG + Exonic
1180233784 21:46444093-46444115 CAAGAAGTCCCGCCCTGTTCTGG + Intronic
1180681316 22:17628832-17628854 CAGGAAGTCCCGCCCTGTCCCGG + Intergenic
1181039765 22:20186464-20186486 CCTCAAGTCCCTCCCTGCACAGG - Intergenic
1181365368 22:22372381-22372403 CCTGGAGGCCCGCCCTGAGAAGG - Intergenic
1183361030 22:37383609-37383631 CCTGCAGTTCAGCCCTGGGCTGG + Intronic
1184817810 22:46885278-46885300 CCTGAGGTCCCACACTGCTCAGG - Intronic
1185005720 22:48275709-48275731 CCTGAGGTCCAGCCCAGCTCTGG - Intergenic
1185222830 22:49637482-49637504 CCTGAGCACCCGCCCTGCCCCGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950986137 3:17369606-17369628 CCTGTAATCCCACCCTGCTCGGG - Intronic
952257100 3:31705074-31705096 CCTGAAGTCCCGCCCACAGAAGG + Intronic
953931840 3:47009491-47009513 GCGGAAGTCCCGCCCCTCGCCGG + Exonic
961712160 3:128836029-128836051 CCTGAAGGTCAGCCCTGGGCAGG - Intergenic
963067871 3:141278257-141278279 AGTGAAATCCAGCCCTGCGCTGG + Intronic
968008088 3:195256416-195256438 CCTGAGGTGCGGCCCTGCACAGG + Intronic
968225225 3:196968847-196968869 CCTCCCGGCCCGCCCTGCGCCGG - Intronic
969469194 4:7376964-7376986 CCTGAAGACCGGCTCTGCACTGG + Intronic
971821936 4:31568412-31568434 CCTGAAATCCTGCCATGCTCTGG + Intergenic
981069884 4:140523968-140523990 CCAGGAGCCCCGCCCCGCGCCGG - Intergenic
984850628 4:184149536-184149558 TCTGAAGGCCTGCCCTGGGCAGG + Intronic
985034022 4:185820488-185820510 TCTGAAGGCCAGCCCTGCCCTGG - Intronic
985672424 5:1213441-1213463 CCACATGTCCCGCCCTCCGCAGG + Exonic
990450478 5:55928173-55928195 CCTGAAATCCCACCCTGCCCTGG - Intergenic
992413962 5:76535080-76535102 CCTGAGGTCCAGCCCTGACCTGG - Intronic
993896217 5:93538348-93538370 CCTGTAGTCCCCCACTGCTCGGG + Intergenic
995041492 5:107593291-107593313 ACTGAAGTCCGGTCCTGTGCTGG - Intronic
998006680 5:138661784-138661806 GCGGAAGTGCCTCCCTGCGCTGG - Intronic
998174836 5:139895311-139895333 CCTGTATCCCAGCCCTGCGCTGG - Intronic
1002603550 5:180369032-180369054 CCTGGAGTCCCGCCGAGCACAGG + Intergenic
1002961084 6:1915407-1915429 CTTGGAGTCCTGCCCTGCTCAGG - Intronic
1006468256 6:34209350-34209372 CCTGCAGTCCCTCCCTACTCTGG + Intergenic
1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG + Intergenic
1013286123 6:108683283-108683305 CCTGAAATCACACCCTGAGCGGG - Exonic
1016010608 6:139134964-139134986 CGTGACGTCACGCCCCGCGCGGG - Intergenic
1016590108 6:145735152-145735174 CCGGAGCTCCCGCTCTGCGCCGG + Intronic
1017880749 6:158560670-158560692 CCTGCGGTCTCGCCCAGCGCCGG + Intronic
1019301211 7:304408-304430 GTTGAAGTCCCGTCCTGCACAGG + Intergenic
1019637438 7:2083569-2083591 CCCGACAGCCCGCCCTGCGCTGG - Intronic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1025697878 7:63789602-63789624 CCCGGAGTCCCTCCCCGCGCTGG + Intergenic
1027236091 7:76298779-76298801 ACTGAAGTCTTGCCCTGCCCAGG - Intergenic
1029405632 7:100372863-100372885 TCTGACGTCCCGCCCTACACAGG - Intronic
1029646096 7:101857003-101857025 TCTGAAGTCCTGCCCAGCTCCGG + Intronic
1034163883 7:149011573-149011595 CCTGAAGACCTGCCCTCCTCGGG + Intronic
1034491541 7:151395703-151395725 CCTGCACTGCCGCCCTGCCCTGG - Intronic
1040850939 8:51899575-51899597 CCAGAAGTTCCCCCCAGCGCCGG + Intergenic
1049470464 8:142773055-142773077 CCTGGAGTCCCTCCCAGCCCTGG + Intronic
1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049747761 8:144270204-144270226 CCTGCATTCCCGCTCTGAGCTGG - Intronic
1049801971 8:144522121-144522143 CCTGTCGCCCCGCCCTTCGCGGG + Exonic
1056817117 9:89810083-89810105 CCTGAATTCCTGCCATGCACTGG - Intergenic
1057218033 9:93240232-93240254 CCTGAATTCCCGCACTGCACTGG - Intronic
1059380192 9:113917368-113917390 CCTGTAGTCCCTCCCTACACGGG - Intronic
1060517037 9:124272344-124272366 CATGAAGTCCCTGCCTGCACAGG + Intronic
1061181632 9:129028063-129028085 CCTGGCGTCGCGCCGTGCGCCGG - Intronic
1062326587 9:136015344-136015366 CCTGAGCTCCCACCCTGCCCCGG - Intronic
1203773020 EBV:58984-59006 CCTGACCTCCCGCCCTGAGCTGG - Intergenic
1187501618 X:19843660-19843682 CCTGAACTCTCTCCCTGGGCAGG + Intronic
1189555615 X:42142242-42142264 CCTCAAGGCCTGCCCTGCCCTGG + Intergenic