ID: 1049611076

View in Genome Browser
Species Human (GRCh38)
Location 8:143555621-143555643
Sequence CCCGTCCCTGCTGGGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611076_1049611091 22 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611091 8:143555666-143555688 CTTCCAGGGGCAGCAGTGTGTGG No data
1049611076_1049611092 23 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611076_1049611089 9 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
1049611076_1049611085 7 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611085 8:143555651-143555673 ACCCCAGGGCGCTGGCTTCCAGG No data
1049611076_1049611081 -8 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data
1049611076_1049611083 -1 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611076_1049611082 -7 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611082 8:143555637-143555659 GGACGGGCTGCCACACCCCAGGG No data
1049611076_1049611087 8 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1049611087 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611076 Original CRISPR CCCGTCCCTGCTGGGTAACA GGG (reversed) Intronic
900175790 1:1290830-1290852 CCCGGCCATCCTGGGTACCACGG - Intronic
900191502 1:1354156-1354178 CCCGGCCCTCCTGGGGACCAGGG - Intronic
900563260 1:3319193-3319215 CCCATCCCTGCCGGGCAGCAGGG - Intronic
900794097 1:4697678-4697700 CCAGCCCCTCATGGGTAACATGG + Intronic
903306076 1:22414231-22414253 CCTCTCCCTGCTGGGGAAGAAGG - Intergenic
908078175 1:60543810-60543832 CCCAGCCCTGCTGGTAAACATGG - Intergenic
909500617 1:76330999-76331021 CCAGCCTCTGCTGGGTAAGATGG + Intronic
909804937 1:79862916-79862938 CCAGACCATGCTGGCTAACACGG - Intergenic
909987808 1:82184020-82184042 CCTCTCCCTCCTGGGTAGCAAGG - Intergenic
910471641 1:87559778-87559800 CCAGACCCTCCTGGGTAACACGG + Intergenic
910666263 1:89728604-89728626 CCCTACCCTCCTGGGTAGCACGG + Intronic
911682484 1:100733335-100733357 CCCATCCCTTTTGGGTATCAGGG + Intronic
912088733 1:106043465-106043487 CCGGTCCATCCTGGCTAACACGG + Intergenic
918379275 1:183938168-183938190 CCCACCCCTACTGGATAACAGGG + Exonic
919597332 1:199580471-199580493 CTCCTGGCTGCTGGGTAACATGG - Intergenic
1062964227 10:1594948-1594970 CCCATCTCTGCTGGGGACCAGGG + Intronic
1070329778 10:75408828-75408850 CCGGACCCTGCTGGGAAACCAGG + Intergenic
1070476985 10:76838449-76838471 CAAGACCATGCTGGGTAACATGG + Intergenic
1075214673 10:120521714-120521736 TCAGTTCCTGCTGTGTAACATGG + Intronic
1075885139 10:125893443-125893465 CGAGACCATGCTGGGTAACACGG - Intronic
1075886318 10:125902347-125902369 CCCGTCCCTAGTGCCTAACACGG + Intronic
1077208884 11:1359017-1359039 CCCTTCCCTGCTGTTTTACATGG - Intergenic
1077453236 11:2663297-2663319 CCCCTCCTGGCTGGGTAAAAAGG + Intronic
1077579280 11:3406483-3406505 ACCGACCCTGCTGGGCAAGAGGG - Intergenic
1078779266 11:14421639-14421661 CCCATCCCCGCTGGGCAACCAGG - Intergenic
1079702530 11:23566696-23566718 CCAGACCCTCCTGGCTAACAAGG - Intergenic
1081850936 11:46274742-46274764 ACCCTCCCTGCTGGGTTAGAAGG + Intergenic
1083814197 11:65122919-65122941 CCAGTCCATCCTGGCTAACAAGG - Intronic
1083896223 11:65621052-65621074 CCCGTCCCTCCTGGGGCACCTGG - Intronic
1083932400 11:65853131-65853153 CCCGTGCCTTCTGGGTAGGAAGG + Intronic
1085540777 11:77267838-77267860 CCCATCTCTGCTTGGTAAAATGG + Intronic
1086297606 11:85388206-85388228 GCTGTCTCTGCTGGGTCACACGG - Intronic
1088597428 11:111450711-111450733 CCGGTCCCTGCAGGGTCAGAGGG + Intronic
1090802426 11:130181175-130181197 CTCGTCCCTGCTGGGTGGGATGG + Intronic
1091975144 12:4818368-4818390 CCCTCCTTTGCTGGGTAACATGG + Intronic
1092261648 12:6956152-6956174 CCCGTCCCTGCAGGATCACTCGG - Exonic
1092263530 12:6964683-6964705 CCCATCCCTGCGGGGAGACAAGG - Intergenic
1092732922 12:11551178-11551200 CCAGACCATCCTGGGTAACACGG + Intergenic
1095467027 12:42498287-42498309 CCCGGCCCTGCTGAGTAGCTGGG + Intronic
1095642385 12:44500559-44500581 CCCGGCACTGCTGGGGAACCCGG - Intergenic
1101158553 12:101951131-101951153 CTCCACCCTGCTGAGTAACAAGG + Intronic
1101751100 12:107582898-107582920 CCCGGGACTGCTGGGTGACAGGG + Intronic
1102099993 12:110270762-110270784 CCCTTCCCTGCCGGGTGCCAGGG - Intergenic
1102350553 12:112188832-112188854 CCCCTCTCTGCTGGGGCACAGGG + Intronic
1102704745 12:114871209-114871231 ACTGTCCCTGCTGGGTGGCAGGG - Intergenic
1103494499 12:121351168-121351190 CCCGGCCAGCCTGGGTAACATGG + Intronic
1103518788 12:121524206-121524228 CCCCTCCCTTCTGGGGAACTTGG + Intronic
1104786672 12:131454833-131454855 CCTGTCCCTGCCGTGTCACATGG - Intergenic
1105923747 13:24987793-24987815 CCCCTCCCAGCTGGGTGTCAGGG + Intergenic
1106555485 13:30804778-30804800 ACCGTCTCCTCTGGGTAACATGG + Intergenic
1112319929 13:98396396-98396418 CCCGTCCCTGCTGAGAAGCCGGG + Intronic
1117918689 14:60705277-60705299 CACTTCCCTACTGGGTATCAAGG - Intergenic
1119525258 14:75317624-75317646 CCCCTCCCAGGTGAGTAACAGGG + Intergenic
1122632071 14:103111716-103111738 CCCGTCCCTGATGGGAAAACAGG + Intergenic
1123721954 15:23068130-23068152 CCAGACCCTCCTGGGCAACATGG + Intergenic
1124260145 15:28182366-28182388 CCCCACCCTGCTGGGTCCCAGGG + Intronic
1128685791 15:69684554-69684576 CCCGTCCTGGCTGTGTCACAGGG + Intergenic
1129452957 15:75661008-75661030 CCCTGCCCTGCTGGGTGATAAGG - Exonic
1129808005 15:78480805-78480827 CCAGACCATCCTGGGTAACACGG + Intronic
1131643189 15:94314041-94314063 CACGCCCCTGCTGGGCCACATGG - Intronic
1133275228 16:4634245-4634267 TCCCTCCCTGCTGGCTCACATGG - Intronic
1133329097 16:4960196-4960218 CACTTCCCTGCTCAGTAACATGG + Intronic
1134812863 16:17182076-17182098 CCGCTCCCTGATGGGTAGCATGG + Intronic
1135687308 16:24508138-24508160 TCCTTCCCTGCTGAGGAACAAGG + Intergenic
1135927644 16:26709721-26709743 TCCTTCCCTGATGGGTTACAAGG - Intergenic
1136076631 16:27821696-27821718 CACGACCATCCTGGGTAACACGG + Intronic
1136294024 16:29291636-29291658 CCCGCCCATCCTGGGTCACAGGG + Intergenic
1138333480 16:56233961-56233983 CCCGGCTCTGCTGGGAAGCATGG + Intronic
1139618722 16:68119067-68119089 CACGACCATGCTGGCTAACACGG - Intronic
1139839095 16:69863737-69863759 CCCGTCGCTGCTGGCAAGCATGG + Intronic
1140325491 16:73997567-73997589 CTGGTCCCTGCTCTGTAACATGG + Intergenic
1142099929 16:88265682-88265704 CCCGCCCGTCCTGGGTCACAGGG + Intergenic
1142535652 17:616082-616104 CCCGTCCCACCTGGGTAAAGTGG + Intronic
1142576204 17:909738-909760 CCAGACCCTCCTGGCTAACATGG - Exonic
1144557270 17:16293320-16293342 CCAGTCCATCCTGGCTAACACGG + Intronic
1148774593 17:50088353-50088375 CCCGGCCCACCTGGGTAACACGG + Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1149858180 17:60103393-60103415 CCAGACCATGCTGGCTAACACGG - Intergenic
1150507267 17:65712081-65712103 CCCTTCCCTGCTTGGTCAGAGGG + Intronic
1151944996 17:77314858-77314880 CCCCTCCCCACTGGGTACCAGGG + Intronic
1152174394 17:78777899-78777921 CCTGTCCCTGCTGCGTAAGTTGG - Intronic
1152928833 17:83099918-83099940 CCCCTCCCTGCTGGGTGAGCCGG - Intergenic
1154350140 18:13576219-13576241 CCAGACCATCCTGGGTAACACGG + Intronic
1159576276 18:70181542-70181564 CCCTTCCATGCTGAGTTACAGGG + Intronic
1161312671 19:3603599-3603621 CCAGTCCCTCCTGGGTCTCAGGG + Intronic
1161720117 19:5897789-5897811 ACCGTCCCTGCTGGGTGCCTAGG + Intronic
1163251354 19:16128099-16128121 CCGGGCCCTGCTGGGAGACATGG + Intronic
926060670 2:9802821-9802843 CCCCTCCTTGATGGGGAACACGG - Intergenic
926130064 2:10297386-10297408 ACCGTGGCTGCTGGGGAACAGGG - Intergenic
927818822 2:26244744-26244766 CCCCTCGCTCCTGGCTAACATGG + Intronic
931583632 2:63804455-63804477 CCAGACCATCCTGGGTAACACGG - Intronic
932890961 2:75597276-75597298 CGAGACCATGCTGGGTAACACGG + Intergenic
938813461 2:134875199-134875221 CCAGGACCTGCTGGGCAACATGG - Intronic
940054699 2:149501124-149501146 CCTGTCCCTGCTGGTTGTCACGG - Intergenic
941199435 2:162490972-162490994 CCCCTCCCAGCTGGGGTACATGG + Intronic
945739101 2:213639569-213639591 CCCATCCCTGCTAGCTTACAGGG + Intronic
946392705 2:219426157-219426179 CCCATCCCTGCCTGGTCACAGGG + Exonic
948530468 2:238600452-238600474 CCAGGCCTTGCTGGGGAACATGG + Intergenic
948607382 2:239144626-239144648 CCCGTCTTTCCTGCGTAACAGGG + Exonic
948825360 2:240571195-240571217 CCTGGCCCTGCTGGGCAGCAAGG - Intronic
1172232799 20:33348340-33348362 CCCCTCCCTGCTGGGCCCCAGGG + Intergenic
1172617773 20:36300464-36300486 CCAGCCCCTCCTGGGTACCAGGG - Intergenic
1173864875 20:46307492-46307514 ACCGTCCCCGCTGGGGAAGAAGG - Intronic
1174171279 20:48619586-48619608 CCCGTGGCTGCTGGGTATCAGGG - Intergenic
1175993235 20:62799931-62799953 CCCGTGGCTGCTTGGTGACATGG + Exonic
1176115074 20:63428659-63428681 GCTGTCCCTGCTGGTTGACAAGG - Intronic
1176168211 20:63685556-63685578 CCCAGCCCTGCTGGGGAACCAGG - Exonic
1176168238 20:63685634-63685656 CCCAGCCCTGCCGGGGAACAAGG - Intronic
1176258768 20:64167913-64167935 CTCTTCCCTTCTGGGAAACACGG - Intronic
1177832921 21:26159279-26159301 CCAGTCCATCCTGGCTAACATGG - Intronic
1182207672 22:28645159-28645181 CCAGTTCGTGCTGGGCAACAAGG + Intronic
1182597889 22:31436211-31436233 CCCAACCCTGCAGGGGAACAGGG + Intronic
1182648460 22:31829782-31829804 CCTGTCTCTGCTGGGCAGCAGGG - Intronic
1183244520 22:36683697-36683719 TCCTTCCCTGCTGGTTGACAGGG + Intronic
1184979632 22:48086723-48086745 CCCGTGCCTGCATGGGAACAGGG + Intergenic
1185045106 22:48524807-48524829 CCTGTCCCTGCTGGGAAACGTGG + Intronic
952051303 3:29387698-29387720 CCAGACCATCCTGGGTAACACGG + Intronic
952265239 3:31778879-31778901 CCAGTCCCTTCTGGCTAATAAGG - Intronic
952899778 3:38102330-38102352 CCTTCCCCTGCTGGGTGACAGGG + Intronic
956667790 3:71658420-71658442 CAAGGCCCTGCTGGGTAACGAGG + Intergenic
956898684 3:73690634-73690656 CGAGACCATGCTGGGTAACATGG + Intergenic
958039304 3:88207002-88207024 CCCCTCCCTGCTGGGGAGAAAGG - Intergenic
961639471 3:128355980-128356002 CCAGGCCCTGCTGGGCACCAGGG + Intronic
962487397 3:135857977-135857999 CACGCCACTGCTGGGTGACAGGG - Intergenic
962910662 3:139846758-139846780 CCCTACCCTGCTGGGTCTCATGG - Intergenic
963083478 3:141415875-141415897 ACCTTCCCTGCTTGGCAACAGGG - Intronic
969570412 4:8004960-8004982 GGCTTCCCTGCTGGGGAACAGGG + Intronic
971264724 4:25087750-25087772 ACGGTCCCTGCTGGGAAACCTGG - Intergenic
985941660 5:3141106-3141128 CCAGACCCTCCTGGCTAACACGG + Intergenic
985957638 5:3276784-3276806 CGCGGCCCTGCAGGGCAACAGGG + Intergenic
991406828 5:66308306-66308328 CCCGTCCCAGATGGTTTACATGG - Intergenic
992216688 5:74531477-74531499 TCCCTCCCTGCTTGGTCACAGGG - Intergenic
996088088 5:119324443-119324465 CCAGTCACTGCTGAGTCACAGGG + Intronic
997237646 5:132282888-132282910 CCTGCCCCTGTTGGGTTACATGG + Intronic
997468783 5:134105077-134105099 CCAGCCTCTGCTGGGTACCAGGG - Intergenic
999252395 5:150190485-150190507 CCCGACTCAGCTGGATAACAGGG + Intronic
1002434419 5:179222064-179222086 CCCGTCCCTGCAGGGTTGGATGG - Intronic
1003247034 6:4391135-4391157 CCAGTCCCTGCTGGGTGTCTGGG - Intergenic
1006569407 6:34988392-34988414 CCAGACCATCCTGGGTAACATGG + Intronic
1009445002 6:63732023-63732045 CTCCTCCCCACTGGGTAACAGGG - Intronic
1011563995 6:88655531-88655553 TCTGTCCCTGCTGAGTAACTGGG - Intronic
1011990492 6:93509358-93509380 CCAGACCATGCTGGCTAACATGG - Intergenic
1014582434 6:123155373-123155395 CCAGACCATCCTGGGTAACATGG - Intergenic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1022212739 7:28227596-28227618 CCAGACCATGCTGGCTAACATGG - Intergenic
1023056039 7:36290831-36290853 CCCCTCACTGCTGGGAATCAAGG + Intronic
1026390984 7:69901292-69901314 CCCGCCCCAGCAGGGTAAGAAGG + Intronic
1029883169 7:103838003-103838025 CCAGACCATCCTGGGTAACACGG + Intronic
1032467464 7:132155261-132155283 CACCTCCCTGCTGTGTAACCTGG + Intronic
1033472862 7:141665089-141665111 CCCGACCCCACTGGGAAACAAGG + Intronic
1033491341 7:141846549-141846571 CCTGTCCCTGTTGGGTTATATGG - Intergenic
1037319596 8:17630647-17630669 CCCCTCCCTGCTGGGGCACCAGG + Intronic
1037903333 8:22701012-22701034 CCCGTCCCTGCTGACTGAGAAGG - Intergenic
1038015309 8:23509680-23509702 CCGCTTCCTGCTGGGTAGCATGG + Intergenic
1046152851 8:110251344-110251366 TCCCTCACTTCTGGGTAACATGG + Intergenic
1046522797 8:115346608-115346630 CGCGACCCTCCTGGCTAACACGG + Intergenic
1047143296 8:122167118-122167140 CCCAACCCTGCTGGGTTGCATGG + Intergenic
1047760231 8:127949150-127949172 CCCTTCCTTGCTGACTAACATGG - Intergenic
1048320477 8:133395896-133395918 CAGGTCCCTGCTGTGTAAAATGG + Intergenic
1048352749 8:133629298-133629320 CCCTTCCCAGCTGTGTAACCTGG + Intergenic
1049302808 8:141880494-141880516 CCCCTCCTTGCTGGGCATCATGG + Intergenic
1049611076 8:143555621-143555643 CCCGTCCCTGCTGGGTAACAGGG - Intronic
1056382630 9:86068821-86068843 CCAGTCCCAACTGGGTATCAGGG + Intronic
1056419084 9:86406203-86406225 TCCCTCTCTGCTGGGGAACATGG + Intergenic
1059311866 9:113393764-113393786 CCAATCCCTGCTGGTCAACAAGG + Intronic
1059446453 9:114341290-114341312 CCCTTCACTGCTGGGTCCCAGGG + Intronic
1060815754 9:126634281-126634303 CCCGTCACTGCTGGGCAAGAAGG - Intronic
1061864918 9:133487280-133487302 CCAGCCCCTGCGGGGAAACAGGG + Intergenic
1062656859 9:137608181-137608203 CCAGACCCTCCTGGCTAACACGG - Intronic
1186208862 X:7229475-7229497 CCCATCCTAGCTGGGGAACAGGG + Intronic
1187135220 X:16541637-16541659 CGAGTCCATCCTGGGTAACAAGG - Intergenic
1188886807 X:35560950-35560972 CCCGCCCCTGCTGGTGCACATGG + Intergenic
1189319153 X:40076972-40076994 GCCTACCCTCCTGGGTAACACGG - Intronic
1198219798 X:134588894-134588916 CCAGTCCCTTCAGGGAAACAGGG - Intronic
1199947423 X:152680234-152680256 CCAGGCCCTGCTGGGAGACAAGG + Intergenic
1199962257 X:152788220-152788242 CCAGGCCCTGCTGGGAGACAAGG - Intergenic