ID: 1049611078

View in Genome Browser
Species Human (GRCh38)
Location 8:143555622-143555644
Sequence GCCCGTCCCTGCTGGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611078_1049611082 -8 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611082 8:143555637-143555659 GGACGGGCTGCCACACCCCAGGG No data
1049611078_1049611083 -2 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611078_1049611092 22 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611078_1049611091 21 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611091 8:143555666-143555688 CTTCCAGGGGCAGCAGTGTGTGG No data
1049611078_1049611081 -9 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data
1049611078_1049611089 8 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
1049611078_1049611087 7 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611087 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data
1049611078_1049611085 6 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049611085 8:143555651-143555673 ACCCCAGGGCGCTGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611078 Original CRISPR GCCCGTCCCTGCTGGGTAAC AGG (reversed) Intronic
900564011 1:3323576-3323598 GCCAGTGCCTGCTGGGTCCCAGG + Intronic
902898496 1:19496427-19496449 GCCCAACCCTGGTGGGTGACTGG - Intergenic
903132497 1:21289401-21289423 CCCCGTCCCTGCCTTGTAACAGG - Intronic
903274144 1:22210167-22210189 GCCCGGCCCTGCTGTGGGACAGG + Intergenic
903886932 1:26546139-26546161 GCCTGGCCCTGCAGGGTGACTGG + Intronic
904936355 1:34132325-34132347 CCCAGGCCCTGGTGGGTAACAGG + Intronic
905461692 1:38126529-38126551 GCCCACCCCTGCTGGGTCCCCGG + Intergenic
907472454 1:54682753-54682775 GCCCGGCCCTCCTTGGTGACGGG - Exonic
913718518 1:121565407-121565429 GCCTGTGCCTGATGGGTTACAGG + Intergenic
923917099 1:238520867-238520889 ACCCTTACCTGCTGGGAAACAGG + Intergenic
1073221375 10:101877092-101877114 GCCAGTCCCAGCTGAGTAGCTGG - Intronic
1075383178 10:122035267-122035289 GCCCCTCCCTGCTGGGCATCTGG + Intronic
1076189284 10:128471297-128471319 GCACGTCCCTTCTGGGTCTCAGG - Intergenic
1076479871 10:130777962-130777984 GCCCCTCCCTGTTGGGTGGCAGG + Intergenic
1078510740 11:11982289-11982311 GACAGGCCCTGCTGGGTAAAGGG + Intronic
1084768639 11:71328365-71328387 GCCCTTGCCTGCTGAGTAGCTGG + Intergenic
1091563352 12:1630446-1630468 GCCCTTCCCTGCTGGCTCCCGGG - Intronic
1092746312 12:11675697-11675719 GCCCCAGCCTCCTGGGTAACTGG - Intronic
1095467025 12:42498286-42498308 CCCCGGCCCTGCTGAGTAGCTGG + Intronic
1095564587 12:43607234-43607256 GCCTGTGCCTGATGGGTTACAGG - Intergenic
1101751098 12:107582897-107582919 GCCCGGGACTGCTGGGTGACAGG + Intronic
1104897221 12:132170395-132170417 GCCCGCTCCTCCTGGGAAACGGG + Intergenic
1105923745 13:24987792-24987814 GCCCCTCCCAGCTGGGTGTCAGG + Intergenic
1107110606 13:36693557-36693579 GGCTGTCCCTGTTGGGTGACAGG - Intronic
1112319927 13:98396395-98396417 CCCCGTCCCTGCTGAGAAGCCGG + Intronic
1122575529 14:102739256-102739278 GCCCCACCCTGCTGGGTCCCAGG - Intergenic
1123947587 15:25246276-25246298 GACCGTCCCTGTTGAGTAATGGG + Intergenic
1124260143 15:28182365-28182387 GCCCCACCCTGCTGGGTCCCAGG + Intronic
1124889853 15:33722781-33722803 GCCCGGCCCTGCGGGGTGAGGGG + Exonic
1126097877 15:45102016-45102038 GCCTGACCTTGCTGGGTGACAGG - Intronic
1129253360 15:74320542-74320564 GCCAGGCCCTGCTGGGGAGCAGG + Intronic
1129372462 15:75106139-75106161 GCCCGGCACTGCTGGGCACCGGG - Intronic
1132101202 15:99024659-99024681 GCCCATACCTGCAGGGGAACAGG - Intergenic
1132374649 15:101321023-101321045 GCACTTCTCTGCTGGGAAACAGG + Intronic
1132426823 15:101724590-101724612 CCCCGCCCCTGCAGGGTATCTGG - Exonic
1132426843 15:101724635-101724657 CCCCGCCCCTGCAGGGTATCTGG - Intergenic
1133883602 16:9805807-9805829 GCCCTTCCCCGATGGGTACCCGG - Intronic
1135133015 16:19868257-19868279 GCCCCTGCCTCCTGGGTAGCTGG - Intronic
1139267345 16:65652365-65652387 GCCCGTGCCTGCTGGCTCTCTGG - Intergenic
1141030538 16:80583998-80584020 GCCCATCTCTGCTGTGTACCAGG + Intergenic
1142412056 16:89921877-89921899 GCCCGCCTCTGCTGGGAGACCGG + Intronic
1142423876 16:89990437-89990459 GCCCCTGCCTGCTGGGAAAGGGG - Intergenic
1143602011 17:7953171-7953193 GCCCGTCCCTGCTGCCAAAAAGG - Intergenic
1148211892 17:45813573-45813595 GCGCGGCGCTGCTGGGGAACTGG + Intronic
1148839351 17:50484670-50484692 GCTCGGCCCTGCTGGGTGATGGG + Intronic
1149595524 17:57862540-57862562 CCCCATCCCTGCTGGGTGACCGG + Exonic
1150507265 17:65712080-65712102 GCCCTTCCCTGCTTGGTCAGAGG + Intronic
1152215550 17:79029734-79029756 GCCCCTCACTGCTAGGAAACGGG + Intronic
1152221937 17:79073674-79073696 GCCCGTCCTTCCTGCCTAACTGG + Intergenic
1152603943 17:81279362-81279384 GCCTGTCCCTGTTGGGTGGCGGG - Intronic
1152618212 17:81347500-81347522 GTCCATCCCTGCAGGGTAAGTGG + Intergenic
1157288355 18:46392757-46392779 CCCCGTCCGGGCTGGGTACCTGG - Intronic
1159067308 18:63585023-63585045 GCCCCACCCTCCTGAGTAACTGG + Intergenic
1160499559 18:79395407-79395429 GCCCGGCCCTGCTGGAAAAGGGG - Intergenic
1163304916 19:16471905-16471927 GCCCGTACCTGCTGGGAGAGGGG + Exonic
1164650800 19:29890085-29890107 GCCAGTCCCTTCTGGCTACCTGG + Intergenic
926130065 2:10297387-10297409 GACCGTGGCTGCTGGGGAACAGG - Intergenic
928223490 2:29425347-29425369 GCCTGTCCCTCCTGGGTACCAGG - Intronic
930641627 2:53859653-53859675 GCCCGTCCCTGCCGGTTCCCAGG - Intronic
936817116 2:116473127-116473149 GCCCTTCCCTGATGTGTATCTGG + Intergenic
939014921 2:136891669-136891691 GCCCATCCAAGCTGGGTCACAGG + Intronic
939504373 2:143027518-143027540 GCCTGTCCCTGCTCTGTAGCTGG + Intronic
946053242 2:216880979-216881001 GCCGGTCCCTACTCTGTAACCGG - Intergenic
946392703 2:219426156-219426178 GCCCATCCCTGCCTGGTCACAGG + Exonic
948607380 2:239144625-239144647 GCCCGTCTTTCCTGCGTAACAGG + Exonic
1169646761 20:7819738-7819760 GCCAGTGCCAGCTGGGTTACTGG + Intergenic
1170963927 20:21049749-21049771 ACCCCTCCCTGCTGGGTAACTGG - Intergenic
1174171281 20:48619587-48619609 ACCCGTGGCTGCTGGGTATCAGG - Intergenic
1178551567 21:33543470-33543492 GCCCGTCCCTGGCGGACAACCGG - Intronic
1183324263 22:37183025-37183047 GACCCTCCCTGCTGGGTGAGGGG - Intronic
954293335 3:49661138-49661160 GCCAGGCTCAGCTGGGTAACTGG - Exonic
961639469 3:128355979-128356001 GCCAGGCCCTGCTGGGCACCAGG + Intronic
963083479 3:141415876-141415898 GACCTTCCCTGCTTGGCAACAGG - Intronic
966544979 3:181136527-181136549 GCCTGAGCCTCCTGGGTAACTGG - Intergenic
967996193 3:195168550-195168572 GCCCATGCTTGCTGGGTGACTGG - Intronic
968745536 4:2357924-2357946 GCCCCTCGCTGCTTGGTAAGCGG + Intronic
969315393 4:6378635-6378657 GGCCGGCCCTGCTGGGTCCCCGG - Intronic
978908516 4:114038113-114038135 GACCCTCCCTGCTGGGTTGCTGG - Intergenic
981116045 4:140992660-140992682 GGCCCTCCCTGATGGGTAAGGGG + Intronic
989960079 5:50402654-50402676 GCCTGTGCCTGATGGGTTACAGG - Intronic
990299627 5:54437416-54437438 GCTTGTGCCTGCTGGGTCACTGG + Intergenic
996459510 5:123725279-123725301 GCCCTTCCCTGCAAGGCAACAGG - Intergenic
997845065 5:137278631-137278653 GTCAGTGCCTGTTGGGTAACAGG - Intronic
999252393 5:150190484-150190506 GCCCGACTCAGCTGGATAACAGG + Intronic
1001909713 5:175505420-175505442 GCCCCGGCCTCCTGGGTAACTGG - Intronic
1003247036 6:4391136-4391158 TCCAGTCCCTGCTGGGTGTCTGG - Intergenic
1007840541 6:44712517-44712539 GCTCCTCCCTGCTGGGTGTCAGG - Intergenic
1009445003 6:63732024-63732046 GCTCCTCCCCACTGGGTAACAGG - Intronic
1011563996 6:88655532-88655554 TTCTGTCCCTGCTGAGTAACTGG - Intronic
1013368866 6:109453955-109453977 GCCCGGCCCTGCTGGTAGACAGG + Exonic
1017781939 6:157722046-157722068 GCCCGTTCCTGCTGGGTCCCCGG + Intronic
1017962530 6:159233956-159233978 GCGCTGCCCTGCTGGGTACCCGG - Exonic
1024308625 7:47948840-47948862 GCCTGAGCCTCCTGGGTAACTGG - Intronic
1024676228 7:51640172-51640194 GCCCGTCCCTGCAAGGTGACAGG + Intergenic
1042689669 8:71484150-71484172 GCCCATCCCTGCAGGGGAAAGGG + Intronic
1049611078 8:143555622-143555644 GCCCGTCCCTGCTGGGTAACAGG - Intronic
1049865056 8:144929845-144929867 GCCCCTCCCTGCTGGCCAGCAGG - Intergenic
1055778808 9:79796554-79796576 ATCCTTCCCTGCTGTGTAACTGG + Intergenic
1061849763 9:133407481-133407503 GCCCGGCCCTGCTGAGCAGCTGG - Intronic
1061864916 9:133487279-133487301 GCCAGCCCCTGCGGGGAAACAGG + Intergenic
1061931572 9:133835691-133835713 GCGCGTCCCTGCTGGATCTCGGG - Intronic
1062137682 9:134938336-134938358 GCCTGTCCCTGCTGGGCCCCAGG - Intergenic
1189438065 X:41010288-41010310 GCCCCTCCCTGCTGTGTTTCCGG + Intergenic
1194976019 X:100396732-100396754 GCCCATCCCCACTGGGAAACCGG + Intronic
1197317261 X:124982458-124982480 TCCCTTCCCTGCTGGATAAGAGG - Intergenic
1199526071 X:148793270-148793292 GGCCTACACTGCTGGGTAACTGG + Intronic