ID: 1049611078

View in Genome Browser
Species Human (GRCh38)
Location 8:143555622-143555644
Sequence GCCCGTCCCTGCTGGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611078_1049611082 -8 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611082 8:143555637-143555659 GGACGGGCTGCCACACCCCAGGG No data
1049611078_1049611083 -2 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611078_1049611089 8 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
1049611078_1049611091 21 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611091 8:143555666-143555688 CTTCCAGGGGCAGCAGTGTGTGG No data
1049611078_1049611081 -9 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data
1049611078_1049611087 7 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611087 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data
1049611078_1049611085 6 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611085 8:143555651-143555673 ACCCCAGGGCGCTGGCTTCCAGG No data
1049611078_1049611092 22 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611078 Original CRISPR GCCCGTCCCTGCTGGGTAAC AGG (reversed) Intronic