ID: 1049611079

View in Genome Browser
Species Human (GRCh38)
Location 8:143555629-143555651
Sequence TGTGGCAGCCCGTCCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611079_1049611091 14 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611091 8:143555666-143555688 CTTCCAGGGGCAGCAGTGTGTGG No data
1049611079_1049611085 -1 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611085 8:143555651-143555673 ACCCCAGGGCGCTGGCTTCCAGG No data
1049611079_1049611087 0 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611087 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data
1049611079_1049611089 1 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
1049611079_1049611092 15 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611079_1049611083 -9 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611079_1049611094 30 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1049611094 8:143555682-143555704 TGTGTGGGCTCCTTGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611079 Original CRISPR TGTGGCAGCCCGTCCCTGCT GGG (reversed) Intronic
900477636 1:2883422-2883444 TGAGGCTGCCTGGCCCTGCTGGG + Intergenic
900526092 1:3129554-3129576 CGGGGCAGACCCTCCCTGCTGGG + Intronic
900997523 1:6130461-6130483 TGTGGCCACCCGTCTCTGATGGG - Intronic
902602916 1:17552149-17552171 TGAGGGAGGCAGTCCCTGCTGGG + Intronic
902694509 1:18131157-18131179 TGAGGCTTCCTGTCCCTGCTTGG + Intronic
903127478 1:21257744-21257766 TGTGTCATCCCGTCCCTGAGTGG - Intronic
905248355 1:36630089-36630111 TGTGACATCCCTTCCCTGCTGGG + Intergenic
907401966 1:54229789-54229811 TGTGGCACCCAGTCCCGGCCAGG - Intronic
909282224 1:73770449-73770471 TGTGGCAGCCCCACCCTCCCAGG + Intergenic
912628535 1:111226956-111226978 GGTGCCAGCTCGTCTCTGCTTGG + Intronic
914408675 1:147403124-147403146 GGTGTCAGTCCGCCCCTGCTGGG - Intergenic
917747140 1:178021303-178021325 TGTGGGACCCCATCGCTGCTAGG - Intergenic
918159354 1:181882937-181882959 GGTGTCAGCCAGCCCCTGCTAGG - Intergenic
922452801 1:225750462-225750484 GGTGGCAGCCTCTCCCTGCATGG - Intergenic
923203886 1:231739476-231739498 TGTGGCAGCCCCTGCATCCTTGG + Intronic
924467521 1:244311993-244312015 GGTGGCAGCCCCTCCCCTCTTGG + Intergenic
924621259 1:245663120-245663142 TGTGGCTGCCTGGCTCTGCTTGG + Intronic
1065622877 10:27601111-27601133 TGTGGCTGCCAGGCCCTGATAGG + Intergenic
1067694452 10:48524510-48524532 TGTGGCCCCCCACCCCTGCTTGG - Intronic
1071108596 10:82127810-82127832 TGGGGCATCCCCACCCTGCTAGG + Intronic
1072810661 10:98459020-98459042 TGTGTCAGCCCTGGCCTGCTGGG - Intronic
1074447236 10:113530550-113530572 TCTGACAGCCCCTCCCTGCAGGG - Intergenic
1074850601 10:117436555-117436577 TGTAGCTGCCCTTCCCTGCAAGG - Intergenic
1075383177 10:122035260-122035282 TTGGGAAGCCCCTCCCTGCTGGG + Intronic
1075714795 10:124549976-124549998 TGTGCCACCCAGTCCCTGCGAGG - Intronic
1075790454 10:125080496-125080518 GGTGGCAGCCCTCCCATGCTAGG - Intronic
1076588906 10:131570105-131570127 TTCCGCAGCCTGTCCCTGCTGGG + Intergenic
1077266523 11:1653432-1653454 TGGGACAGCCCTTCCCTGCTGGG + Intergenic
1077305843 11:1868414-1868436 TGTGGCAGCCACACCGTGCTTGG + Intronic
1077316382 11:1921115-1921137 TGTGACAGCCCAGCCCTCCTTGG - Intronic
1077579044 11:3405121-3405143 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1083881703 11:65552116-65552138 TGTGGTATCCCTTCCCAGCTGGG + Exonic
1084236066 11:67788640-67788662 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1085066334 11:73498881-73498903 TATGGCTACCCGTCCCCGCTAGG - Intronic
1087101697 11:94371105-94371127 GGTGTCAGTCCGCCCCTGCTGGG - Intergenic
1087131287 11:94671570-94671592 GGTGGGAGCCCCACCCTGCTGGG + Intergenic
1088883085 11:113986912-113986934 TGCAGCAGCCCGTGCCTGCTTGG + Exonic
1090003343 11:122980268-122980290 TGTGGCAGCTTCTCTCTGCTTGG - Intronic
1091616061 12:2052504-2052526 TGCGGCGGCGCGTCCCTGCTGGG - Intronic
1092257593 12:6935971-6935993 TGAGGCAGCCCCTCCCCCCTTGG - Exonic
1092406975 12:8228004-8228026 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1094333647 12:29323495-29323517 TGTGTCAGTCCGCCCCTACTGGG - Intronic
1095953912 12:47795906-47795928 TGGGGCTGCCCGCCCCTGCCAGG - Exonic
1100379435 12:94048045-94048067 TGTGCCAGTCCTTCCCTGCTAGG + Intergenic
1103176210 12:118865637-118865659 TGAGGCATCCCATCCCTGCCTGG - Intergenic
1103535774 12:121633034-121633056 TGAGGCAGCCCTCCCATGCTGGG - Intronic
1105766790 13:23567768-23567790 TCAGGCAGCCCCTCCCTTCTTGG + Intergenic
1106090583 13:26589428-26589450 TATGGTTGCCCATCCCTGCTGGG - Intronic
1110353350 13:74537098-74537120 TGTGTCAGTCTGTCCCTGCTAGG - Intergenic
1111959234 13:94791637-94791659 TGTGTCAGACAGTCCCAGCTAGG + Intergenic
1113535714 13:111064810-111064832 TGTGACAGGCCGTGCCAGCTTGG - Intergenic
1115832288 14:37356172-37356194 GGTGTCAGTCTGTCCCTGCTGGG + Intronic
1119087407 14:71750916-71750938 TGAGGCTGCCCTTCCCTGTTTGG + Intergenic
1119528393 14:75341433-75341455 TGTGGAAGCCTGTGCATGCTGGG - Intergenic
1119613358 14:76082350-76082372 GGTGGCAGCCCCTCCCAGGTAGG + Exonic
1121048063 14:90802367-90802389 TGTGGCAGCCCGGTCCTGAGAGG + Intronic
1121783794 14:96639662-96639684 TGTGGCAGGCTGGCCTTGCTTGG + Intergenic
1122827495 14:104377331-104377353 TGTGGAGGCCCCTCCCTGCCTGG + Intergenic
1122982534 14:105198102-105198124 TGAGGCAGCCCCTCTCTTCTGGG + Intergenic
1124007363 15:25805254-25805276 TGTGGCAGCCGGTCCCTCCAAGG + Intronic
1125201338 15:37102542-37102564 TGAGTCTGGCCGTCCCTGCTCGG - Intergenic
1127979443 15:64023951-64023973 TGTTGCAGCACCTCCCTGATTGG - Intronic
1129466307 15:75726050-75726072 TGTGGCACACCATCCCTGCAGGG - Exonic
1132605410 16:791772-791794 TGTGGCAGTCCCTGGCTGCTAGG + Intronic
1133050564 16:3115192-3115214 TCTTGCCGCCCGTCCTTGCTGGG + Intronic
1133347645 16:5081201-5081223 TGTGCCAGCCCCTCCCTGCCAGG + Intronic
1133928508 16:10213155-10213177 CTTGGCAGCCCGACCCTGCCAGG - Intergenic
1134105755 16:11485069-11485091 TGTGGCTTCCCTTCCCAGCTTGG - Exonic
1134116626 16:11553533-11553555 TGCGGGAGCCTGTGCCTGCTGGG - Exonic
1135401787 16:22171058-22171080 TTTGGGAGCCCCTTCCTGCTAGG - Intronic
1136574087 16:31113012-31113034 TGGGGCACCCAGTCCCTGCTAGG - Intergenic
1140252537 16:73306740-73306762 TCTAGCAGCCTGTCACTGCTGGG - Intergenic
1140999384 16:80294339-80294361 AGTGGCAGCAAGGCCCTGCTGGG + Intergenic
1141775460 16:86120008-86120030 TGTGGCAGCATGTACCTACTTGG + Intergenic
1147285895 17:39402192-39402214 TGCAGCAGGCGGTCCCTGCTCGG + Intronic
1147569154 17:41557007-41557029 GGTGGCAGCCCCTGCCTTCTTGG - Intergenic
1150357612 17:64500868-64500890 TTTTGCAGCCCGTACCTTCTTGG - Intronic
1154976010 18:21458486-21458508 TCTGGCAGCTCTTCCCTGCCTGG - Intronic
1156463107 18:37332677-37332699 GGAGGGAGCCCCTCCCTGCTAGG + Intronic
1158505762 18:58044712-58044734 AGTGGCACCCCCTTCCTGCTCGG + Intronic
1160453523 18:78980391-78980413 TGGGGCTGCCCGTCCGGGCTGGG + Intronic
1160748090 19:720739-720761 TGGGGCAGCCTGTCCCTGCCCGG - Intronic
1162440239 19:10688070-10688092 TGGTGCAGCCCGGGCCTGCTGGG - Intronic
1163398889 19:17079793-17079815 TGTGCCAGGCTGCCCCTGCTCGG + Intronic
1163675984 19:18655549-18655571 TGTGGCAGGCAGTCTCTGATGGG - Intronic
1167093586 19:47361160-47361182 AATGGCAGGCCGTCCCGGCTGGG + Intronic
1168414146 19:56158390-56158412 TGTGCAATCCCATCCCTGCTGGG - Intronic
925329393 2:3046817-3046839 TGTGGGAGCCGGTGCCTGCCTGG - Intergenic
925638489 2:5965219-5965241 TGTGGCAGCCCCTCCCATCCAGG - Intergenic
926061114 2:9805858-9805880 TGTGCCATCCATTCCCTGCTGGG + Intergenic
927919500 2:26961172-26961194 TGTGGCAGGCCATGCCCGCTTGG + Intergenic
930289926 2:49481084-49481106 TGTGTCAGTCCGCCCCTACTCGG - Intergenic
930601678 2:53451151-53451173 TGAGGCTGCCCTTCCCTCCTCGG - Intergenic
931109199 2:59092134-59092156 TGTGTCAGTCTGCCCCTGCTTGG + Intergenic
931775867 2:65539839-65539861 TGTGGGAGCCTGTCCCTGTCAGG + Intergenic
933938980 2:87229754-87229776 AGGTGCAGCCCGGCCCTGCTGGG - Intergenic
935729836 2:106056177-106056199 TGTGGCAGCCCCTGCCCTCTTGG + Intergenic
935801370 2:106700111-106700133 TGTTGCAGCCCCTCCTGGCTGGG + Intergenic
936354154 2:111736021-111736043 AGGTGCAGCCCGGCCCTGCTGGG + Intergenic
938718530 2:134043488-134043510 GGTGTCAGTCCGTCCCTACTGGG - Intergenic
940838897 2:158556746-158556768 TGTTGCAGACCATCCCTGTTTGG + Intronic
944649675 2:201817017-201817039 TGTGGCAGCCCTGCTCTGCAAGG + Intronic
944662472 2:201932707-201932729 TGTGCCTGCGCTTCCCTGCTGGG - Intergenic
947791910 2:232873430-232873452 GGTGGCAGCTCACCCCTGCTGGG + Intronic
1171898670 20:30835725-30835747 GGTGGCAGTCCGCCCCTACTGGG + Intergenic
1172863217 20:38073576-38073598 TTTGGCAGCACCTCCCTGCAGGG + Intronic
1173251271 20:41365401-41365423 TGTGGCTGCCCCTCCCTGCGTGG + Intronic
1174338382 20:49880743-49880765 TGTGGCAGCACGCCCATGCTGGG + Intronic
1175374105 20:58513223-58513245 TGTGGAAGCGCGCCTCTGCTGGG - Intronic
1181711808 22:24696017-24696039 GGTGCCAGTCCGTCCCTGCCTGG + Intergenic
1183273852 22:36878839-36878861 TCTGGCAGCCTGTTCCTCCTGGG - Intergenic
1183547108 22:38460221-38460243 TGTGCCACCCCCTCCCTGCCTGG - Intergenic
1184785914 22:46671993-46672015 CGTGGCAGGCCCTCCCTGCAGGG - Intronic
1185037529 22:48487631-48487653 TGAGGGAGCCCCTCCCTGCCAGG + Intergenic
1185038093 22:48489978-48490000 TGGCGCGGCCCGTCCCTGCCCGG + Intronic
951592381 3:24280313-24280335 GGTGTCAGTCTGTCCCTGCTGGG - Intronic
952301180 3:32106234-32106256 TGTGGCAGCCCTTCCCGAGTAGG + Intronic
957052034 3:75418439-75418461 TATGCCAGCCCCTCCCTGCCAGG + Intergenic
961885643 3:130094671-130094693 TGTGCCAGCCCCTCCCTGCCAGG + Intronic
964824366 3:160809024-160809046 CCTGGCAGCCCTTCCCTGCCTGG - Intronic
968273596 3:197423464-197423486 TCTGGGAGCCCATCCCTCCTCGG - Intergenic
968273609 3:197423518-197423540 TCTGGGAGCCCATCCCTCCTCGG - Intergenic
968273622 3:197423572-197423594 TCTGGGAGCCCATCCCTCCTCGG - Intergenic
968273634 3:197423626-197423648 TCTGGGAGCCCATCCCTCCTCGG - Intergenic
968994835 4:3938814-3938836 TGTGCCAGCCCCTCCCAGCCAGG + Intergenic
969597551 4:8157849-8157871 GGTGACAGCCCTTCCCTGCCGGG + Intronic
969759167 4:9169980-9170002 TGTGCCAGCCCCTCCCTGCCAGG - Intergenic
971248174 4:24949226-24949248 TGTGGCATCTCTTTCCTGCTGGG + Intronic
973809200 4:54553643-54553665 TGTGGCAGGCAGGACCTGCTGGG - Intergenic
976777381 4:88721254-88721276 TGTGGCAGGCCAGCTCTGCTGGG - Intergenic
978159197 4:105526464-105526486 TGTGGCAGGCAGTCACTGATGGG + Intergenic
981412031 4:144442913-144442935 TGTGGCAGTCCCTCCCTTCAAGG - Intergenic
981687497 4:147471193-147471215 GGTGTCAGTCCGCCCCTGCTGGG + Intergenic
982775349 4:159435878-159435900 TGTGGCAGCCAGTCACTTCCTGG + Intergenic
985692743 5:1322599-1322621 TGTGGCAGCCCCTCCACGCCAGG - Intronic
985798828 5:1987634-1987656 TGTAGCTGCCCTTCCCTCCTTGG - Intergenic
986375841 5:7130538-7130560 TGTGTCAGTCTGCCCCTGCTGGG + Intergenic
986963600 5:13244363-13244385 GGTGGCAGGCCGGCACTGCTGGG - Intergenic
991538880 5:67704407-67704429 GGTGTCAGTCCGTCCCTACTGGG - Intergenic
991914742 5:71594580-71594602 TGTGGCATCAGGTGCCTGCTGGG + Intronic
994313942 5:98310181-98310203 TGTGGCATCACTTTCCTGCTGGG - Intergenic
994553128 5:101262042-101262064 TGTGGCAGCCCTTCCCATCATGG + Intergenic
997084716 5:130784207-130784229 GGTGTCAGTCCGTCCCTACTGGG - Intergenic
997755908 5:136399393-136399415 TGTGGAAGGCCTTCACTGCTAGG + Intergenic
1000662030 5:163949268-163949290 TATAGGAGCCTGTCCCTGCTGGG - Intergenic
1002184712 5:177448773-177448795 TGAGGCAGCCCTTTGCTGCTTGG - Intronic
1003307142 6:4939903-4939925 TGTGTCAGCCAGTGCCTTCTGGG + Intronic
1007881892 6:45176800-45176822 TGTGTCAGTCTGCCCCTGCTGGG - Intronic
1011684803 6:89815570-89815592 TGTGGCAGGCAGTCACTGATGGG - Intronic
1012226904 6:96714995-96715017 CATGGCCGCCCGTACCTGCTCGG - Intergenic
1014079097 6:117267971-117267993 TAAGGAAGCCCGTCCTTGCTTGG + Intronic
1015087089 6:129308819-129308841 TGTGGAAGTCTGTCCTTGCTTGG - Intronic
1016645977 6:146408768-146408790 TTTGGCAACCTGTCCCTGCTTGG + Intronic
1018606923 6:165607510-165607532 TGTGGCAGCCTGTACCATCTAGG + Intronic
1019328526 7:451645-451667 TGGGGCAGCCACGCCCTGCTGGG - Intergenic
1019916846 7:4138941-4138963 TGTGGCTGCCGGAGCCTGCTAGG + Intronic
1020319096 7:6927137-6927159 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1023887364 7:44368602-44368624 TGTGGCAACCCCTAGCTGCTTGG - Intergenic
1023945217 7:44797295-44797317 GGTGTGAGCCCGTCCATGCTCGG + Intronic
1025249443 7:57342218-57342240 TGGGGCAGCCCTTCCCTGGGGGG - Intergenic
1026802835 7:73410850-73410872 TGTGGCTCCCCGTCCCACCTGGG + Intergenic
1030490441 7:110226139-110226161 TGTGACAGACCTGCCCTGCTGGG - Intergenic
1035561021 8:603370-603392 TGTGACAGCCCCTCCCAGATCGG + Intergenic
1036381315 8:8238011-8238033 TGTGCCAGCCCCTCCCTGCCAGG - Intergenic
1036765639 8:11547853-11547875 GGGGGCAGCCCATCCCTGGTGGG + Intronic
1036847348 8:12178981-12179003 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1036868713 8:12421302-12421324 TGTGCCAGCCCCTCCCTGCCAGG + Intergenic
1038491985 8:27977842-27977864 AGTCGGAGCCCATCCCTGCTTGG - Intronic
1039469971 8:37807283-37807305 TGTGGCTTCCCGTCCCTCCGTGG - Intronic
1042016779 8:64322115-64322137 GGTGGCAGTCCGCCCCTACTGGG + Intergenic
1042115530 8:65427089-65427111 GGTGTCAGTCCGTCCCTACTGGG - Intergenic
1043230461 8:77793952-77793974 GGTGGCAGCTTGTCCCTTCTGGG - Intergenic
1043547414 8:81331119-81331141 GGTGTCAGTCTGTCCCTGCTGGG + Intergenic
1048517383 8:135123314-135123336 TCTTGCAGCCCCTCCCTTCTAGG - Intergenic
1048626877 8:136195460-136195482 GGTGTCAGTCTGTCCCTGCTGGG + Intergenic
1048917998 8:139202756-139202778 TGTGGAAGCCCATCCCAGGTAGG + Intergenic
1049515253 8:143051091-143051113 AGTGGCAGCCCTTCACTGCCTGG + Intronic
1049611079 8:143555629-143555651 TGTGGCAGCCCGTCCCTGCTGGG - Intronic
1049794779 8:144492121-144492143 TGGGCCAGCCCGTCACTGCCGGG + Intronic
1051210006 9:14731353-14731375 ACTGGGAGCCAGTCCCTGCTGGG + Intergenic
1052766302 9:32644727-32644749 TGTGCCAGCCCTTCTCTGCATGG + Intergenic
1053198270 9:36136461-36136483 TGGGGAAGCCCGCGCCTGCTGGG - Intergenic
1056451405 9:86720826-86720848 TGTGTCAGCCGGTCCTTTCTCGG + Intergenic
1056899295 9:90583529-90583551 CGTGGCGGCCCATCCCTGGTGGG - Intergenic
1061237877 9:129352627-129352649 TGTGGCAGCACCTGCCTGCGGGG + Intergenic
1062137683 9:134938343-134938365 TGGGGATGCCTGTCCCTGCTGGG - Intergenic
1062547526 9:137070384-137070406 CGCGGCAGCCCCTCCGTGCTGGG + Exonic
1185827745 X:3268691-3268713 TGCAGCAGCCCATCCCTGCAGGG + Intergenic
1187963266 X:24586255-24586277 TGAGGCAGCCCGTTCCATCTTGG - Intronic
1191205408 X:57828114-57828136 GGTGTCAGTCCGTCCCTACTGGG - Intergenic
1192704211 X:73511786-73511808 GGTGTCAGTCTGTCCCTGCTGGG - Intergenic
1194826881 X:98575742-98575764 TTTGGAGGCCCATCCCTGCTAGG + Intergenic
1195760791 X:108244180-108244202 TATGGCAGCCCAGCCTTGCTTGG - Intronic
1196711669 X:118769851-118769873 CGTGGCAGCACCTCCCTGCCTGG + Intronic
1199552466 X:149074573-149074595 CGGGGGAGCCCCTCCCTGCTTGG + Intergenic
1201635624 Y:16119971-16119993 GGTGTCAGTCTGTCCCTGCTGGG + Intergenic
1202255975 Y:22920534-22920556 TGCTGCAGTCTGTCCCTGCTGGG - Intergenic
1202408966 Y:24554287-24554309 TGCTGCAGTCTGTCCCTGCTGGG - Intergenic
1202461817 Y:25115791-25115813 TGCTGCAGTCTGTCCCTGCTGGG + Intergenic