ID: 1049611080

View in Genome Browser
Species Human (GRCh38)
Location 8:143555630-143555652
Sequence GTGTGGCAGCCCGTCCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611080_1049611085 -2 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611085 8:143555651-143555673 ACCCCAGGGCGCTGGCTTCCAGG No data
1049611080_1049611083 -10 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611080_1049611092 14 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611080_1049611089 0 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
1049611080_1049611095 30 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611095 8:143555683-143555705 GTGTGGGCTCCTTGCCTGCCGGG No data
1049611080_1049611091 13 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611091 8:143555666-143555688 CTTCCAGGGGCAGCAGTGTGTGG No data
1049611080_1049611087 -1 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611087 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data
1049611080_1049611094 29 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC 0: 1
1: 0
2: 0
3: 9
4: 167
Right 1049611094 8:143555682-143555704 TGTGTGGGCTCCTTGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611080 Original CRISPR GTGTGGCAGCCCGTCCCTGC TGG (reversed) Intronic
900557754 1:3288718-3288740 GAGGGGCAGCCTCTCCCTGCAGG + Intronic
900737088 1:4305740-4305762 GTGGGGTAGCCCAGCCCTGCAGG - Intergenic
902602915 1:17552148-17552170 GTGAGGGAGGCAGTCCCTGCTGG + Intronic
902710841 1:18238692-18238714 GTGTGGGAGCCCATCACTGGTGG - Intronic
902984982 1:20149654-20149676 GCCTGGAGGCCCGTCCCTGCTGG - Exonic
905248354 1:36630088-36630110 ATGTGACATCCCTTCCCTGCTGG + Intergenic
906083227 1:43107779-43107801 GAGTGGCTGGCCGGCCCTGCTGG - Intergenic
912701716 1:111882803-111882825 GAGTTCCAGCCCCTCCCTGCTGG - Intronic
922459951 1:225808356-225808378 GTGGGGCAGCCCTGCACTGCAGG - Intergenic
922999474 1:229994934-229994956 GTGTCGCAGCCTGTCCCCGGGGG - Intergenic
923017872 1:230140599-230140621 CTGTGGCAGCGCGTCACTCCAGG - Intronic
1063551981 10:7042176-7042198 GTGGGGTAGCCCTGCCCTGCAGG + Intergenic
1067769556 10:49113767-49113789 GTCTGCCAGCCCCTCCCAGCAGG + Intronic
1072810662 10:98459021-98459043 GTGTGTCAGCCCTGGCCTGCTGG - Intronic
1074447237 10:113530551-113530573 CTCTGACAGCCCCTCCCTGCAGG - Intergenic
1075632670 10:124010666-124010688 GGGTGTCAGCCCGTCCTTGGAGG + Intronic
1075688717 10:124381034-124381056 GTGTGGGAGGCCTTCCCAGCAGG - Intergenic
1075789043 10:125070210-125070232 GTGTGGTGGCACGTGCCTGCAGG + Intronic
1076528842 10:131130890-131130912 GGGTTGATGCCCGTCCCTGCAGG - Intronic
1076588905 10:131570104-131570126 GTTCCGCAGCCTGTCCCTGCTGG + Intergenic
1077266522 11:1653431-1653453 CTGGGACAGCCCTTCCCTGCTGG + Intergenic
1077269206 11:1667227-1667249 GTGTGGCACCCAGGCCCTGCTGG - Intergenic
1077271339 11:1683479-1683501 GTGTGGCACCCAGGCCCTGCTGG + Intergenic
1080188729 11:29521442-29521464 GTGTGGCAGCCCTTGGCTGGTGG - Intergenic
1080553527 11:33394969-33394991 GTGTTTCAGCCTCTCCCTGCAGG - Intergenic
1081798427 11:45839355-45839377 GTGTGGCGGCACGTGCCTGCAGG + Intergenic
1084858602 11:72004099-72004121 GTCTGACAGCCCTTCCTTGCAGG - Exonic
1085375871 11:76060656-76060678 GAGTGGCCGGCCGGCCCTGCTGG + Intronic
1085394536 11:76200644-76200666 GTGAGGCTGTCAGTCCCTGCAGG + Intronic
1087131286 11:94671569-94671591 GGGTGGGAGCCCCACCCTGCTGG + Intergenic
1091616062 12:2052505-2052527 CTGCGGCGGCGCGTCCCTGCTGG - Intronic
1095944470 12:47746239-47746261 GTGTCCCAGCCCCTGCCTGCTGG - Intronic
1098694675 12:73537672-73537694 GGGTGGCAGCTCCTCCTTGCAGG + Intergenic
1101763144 12:107675678-107675700 GTATGGCAGCGTGGCCCTGCAGG - Intergenic
1103342824 12:120230208-120230230 CTATGGCAGCCCGTTGCTGCTGG - Intronic
1105502973 13:20988657-20988679 GGGTGGCAGCCGGCCACTGCTGG + Exonic
1105706891 13:22972796-22972818 GTGTGGTAGCCCAGCCCAGCAGG + Intergenic
1112950778 13:104993816-104993838 GTGTGGCAGCCGCTCCCTTCAGG - Intergenic
1113660650 13:112104673-112104695 GAGTGGCAGCGCGGCCCCGCAGG + Intergenic
1114121901 14:19678593-19678615 GTGTGTCTGCCAGCCCCTGCAGG - Intergenic
1119431879 14:74573725-74573747 GTGTGCCATCCCTTTCCTGCTGG + Intronic
1121352503 14:93184809-93184831 GGGTGGCGGCACGTCCCTCCAGG - Exonic
1122960933 14:105093388-105093410 GCGTGGCGGCCCGCCCCGGCAGG - Intergenic
1129466308 15:75726051-75726073 CTGTGGCACACCATCCCTGCAGG - Exonic
1129659262 15:77543783-77543805 GTGCTGTAGCCCTTCCCTGCTGG + Intergenic
1132617570 16:849430-849452 CTGTGGAAGCCCTGCCCTGCGGG - Intergenic
1133805315 16:9122273-9122295 GTGAGGCAGCCTGTACTTGCCGG - Intergenic
1135992463 16:27226519-27226541 GGGCGGCAGTGCGTCCCTGCGGG + Intronic
1137634299 16:49972503-49972525 GTGTGGAAGCCCTTTTCTGCTGG - Intergenic
1140088532 16:71818124-71818146 CTGGGGCAGCCAGTCCCTGGAGG + Intergenic
1140252538 16:73306741-73306763 GTCTAGCAGCCTGTCACTGCTGG - Intergenic
1141424467 16:83936062-83936084 GCGGGCCTGCCCGTCCCTGCAGG - Intronic
1144575355 17:16426383-16426405 GTGTGGCTGCATGTCCCAGCAGG + Intronic
1145903993 17:28506479-28506501 GTGCCCCAGCCCGGCCCTGCTGG - Intronic
1146054224 17:29573234-29573256 TTGAGGCAGCCCGCCCCCGCTGG + Intergenic
1147270592 17:39267589-39267611 GGGTGGCAGCCAGGCACTGCTGG + Intronic
1147850532 17:43439155-43439177 GTGTGGCTTCCAGTCTCTGCTGG + Intergenic
1148636465 17:49152793-49152815 GCGGGGCAGCCCTTCTCTGCAGG - Exonic
1149646620 17:58245922-58245944 GTGGAGGAGCCCTTCCCTGCTGG + Intronic
1157544822 18:48539974-48539996 GTGTGCGCGCCCGTCCCCGCGGG + Intronic
1158556114 18:58475950-58475972 CAGTGGCAGCACGGCCCTGCTGG + Intergenic
1160123022 18:76147288-76147310 GTCTGGCTGTCTGTCCCTGCAGG + Intergenic
1160366166 18:78327763-78327785 GGGAGGCAACCTGTCCCTGCAGG - Intergenic
1160903355 19:1440254-1440276 GTGTGTGCGGCCGTCCCTGCCGG + Intronic
1163310762 19:16513190-16513212 GTGTGGCACCCCTTGCATGCTGG + Intronic
1164286457 19:23821628-23821650 GTGTGGCAGCCCTTGGCTGGGGG + Intronic
1164682769 19:30146506-30146528 GTGTGGCACACCTCCCCTGCTGG - Intergenic
1165161605 19:33820054-33820076 GAGCAGCAGCCCGGCCCTGCTGG - Intergenic
1165354120 19:35293378-35293400 GAGTGCCAGCCCATCCCTGTGGG + Intronic
925390201 2:3489270-3489292 CTGAGGCAGGACGTCCCTGCGGG - Intergenic
926061113 2:9805857-9805879 GTGTGCCATCCATTCCCTGCTGG + Intergenic
926146112 2:10397999-10398021 GTGGGGCAGCCAGGTCCTGCTGG - Intronic
927900416 2:26814562-26814584 GAGTGGCCGGCCGGCCCTGCCGG + Intergenic
932371342 2:71191111-71191133 GTTTGGCATCCCTTTCCTGCAGG + Intronic
934562156 2:95318973-95318995 CTGTGGCAGCCCAGCCCTGCCGG - Intronic
934791986 2:97069487-97069509 GTGTGGCAGGCCGTGTGTGCAGG - Intergenic
935593549 2:104862616-104862638 GTCTGGCCGCCCGGCCGTGCCGG - Intergenic
935801369 2:106700110-106700132 GTGTTGCAGCCCCTCCTGGCTGG + Intergenic
935846353 2:107169892-107169914 GTGCTTCAGCCCGTCCCTCCTGG - Intergenic
945664238 2:212721336-212721358 GAGTGGCAGGCCGGCGCTGCTGG - Intergenic
947791909 2:232873429-232873451 GGGTGGCAGCTCACCCCTGCTGG + Intronic
948989020 2:241542343-241542365 GTGTGGCAGCCTGGGCCTCCCGG + Intergenic
1171400565 20:24870894-24870916 GTGTGGCAGCTCATCACAGCGGG - Intergenic
1171427196 20:25056823-25056845 GTCTGCCAGCCCCTCCCCGCAGG + Intronic
1172863216 20:38073575-38073597 TTTTGGCAGCACCTCCCTGCAGG + Intronic
1174338381 20:49880742-49880764 CTGTGGCAGCACGCCCATGCTGG + Intronic
1175127812 20:56765384-56765406 GCGTGGCAGCCTGTCCAGGCAGG + Intergenic
1176216727 20:63951608-63951630 GGGTGGCTGCAGGTCCCTGCAGG - Intronic
1176547892 21:8209288-8209310 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1176555788 21:8253501-8253523 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1176566825 21:8392321-8392343 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1176574725 21:8436535-8436557 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1176611339 21:8987828-8987850 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1177107304 21:16975613-16975635 GTGTGGCAGCACATGCCTGTAGG - Intergenic
1179423472 21:41254322-41254344 ACATGGCAGCCCCTCCCTGCTGG + Intronic
1180089688 21:45527543-45527565 GAGTGGCAGCCAGTTACTGCAGG + Intronic
1182137425 22:27919051-27919073 CTGTGTCAGCCCCTCCCTGCGGG - Intronic
1183421407 22:37713678-37713700 ATGTGGCAGCCCGAGCCTGCTGG - Intronic
1184172082 22:42765738-42765760 GTGAGGGAGCCCCTCCCTCCAGG - Intergenic
1184191829 22:42900085-42900107 CTGATGCAGCCCGTCCTTGCTGG + Intronic
1184275336 22:43406551-43406573 GTGGGGCCTCCCGTCCCTCCTGG - Intergenic
1184406764 22:44304857-44304879 GTGGGGCAGCCCCACCCTACGGG - Intronic
1184785915 22:46671994-46672016 ACGTGGCAGGCCCTCCCTGCAGG - Intronic
1185045092 22:48524743-48524765 GTCTGGCCGCCCACCCCTGCTGG - Intronic
1203252773 22_KI270733v1_random:125586-125608 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1203260829 22_KI270733v1_random:170672-170694 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
950097808 3:10340145-10340167 GTCTGGCAGCCCATTCCTGGGGG + Intronic
952287420 3:31981678-31981700 GTGGGGCTGCCCCTCCCTCCAGG - Intronic
952695814 3:36264256-36264278 GTGTGGCTGCAGGTCCCAGCTGG + Intergenic
954863908 3:53712913-53712935 GTGTGGCAAGCCTTCCCTTCGGG + Intronic
959277243 3:104292047-104292069 CTGTGGCAGCAGCTCCCTGCTGG - Intergenic
961661509 3:128471025-128471047 GTGTGTGAGGCCGACCCTGCTGG - Intergenic
962409885 3:135131874-135131896 GTGTGAAAGCCCATACCTGCGGG - Intronic
965561231 3:170063943-170063965 GTGTGGCTTGCCTTCCCTGCCGG + Intronic
968509477 4:989107-989129 GTGTGGAAGCCGGCCGCTGCGGG + Exonic
969153108 4:5187081-5187103 GTGTGTCAGGCAGTTCCTGCAGG + Intronic
969597550 4:8157848-8157870 GGGTGACAGCCCTTCCCTGCCGG + Intronic
969724374 4:8910665-8910687 GGGAGACAGCCCCTCCCTGCAGG + Intergenic
971563550 4:28112872-28112894 GAGTGGCTGGCCGGCCCTGCTGG + Intergenic
973809201 4:54553644-54553666 GTGTGGCAGGCAGGACCTGCTGG - Intergenic
974988585 4:69059027-69059049 GTGTGGCAGCCCCTGGCTGGTGG - Intronic
975562891 4:75724417-75724439 TGGTGGAAGCCCGGCCCTGCAGG - Intronic
985104313 4:186485948-186485970 GTGTGTGAGCCAGTCCCTGTAGG - Intronic
985643913 5:1076236-1076258 CAGTGGCCGGCCGTCCCTGCAGG - Exonic
985649346 5:1100072-1100094 GTGTGGGAGCCCAGCCCGGCCGG - Intronic
986520023 5:8605380-8605402 GTGTGGGAGCCAGTTCCTTCAGG + Intergenic
986707909 5:10466644-10466666 GTGATGAGGCCCGTCCCTGCTGG + Intronic
992297252 5:75337474-75337496 GTGTGGCAGCTCGGACCCGCGGG + Intronic
992709812 5:79440880-79440902 GTGAGGCACCACGTCCCGGCCGG - Intronic
997243490 5:132326069-132326091 GTGGGGCAGCCCTGCTCTGCAGG + Intronic
997371034 5:133360082-133360104 GCGTGGCCTCCCTTCCCTGCAGG + Intronic
998095451 5:139393584-139393606 ACGTAGCAGCCCGTCCCCGCCGG - Exonic
1002053470 5:176585016-176585038 GTAAGGCAGCCTGTCCTTGCAGG + Intronic
1002312578 5:178323592-178323614 GAGTGGCAGCCCCATCCTGCAGG + Intronic
1002319719 5:178367828-178367850 GGGTGGCAGCCCGTACCTCTGGG - Intronic
1002600272 5:180350469-180350491 GATCGGCATCCCGTCCCTGCTGG + Intronic
1003286026 6:4734551-4734573 CTGCAGCAGCCCGTCCCAGCGGG - Intronic
1005901107 6:30216847-30216869 GTGTGGCAGTCCCTCCCTCAGGG - Intergenic
1010454423 6:76038671-76038693 CTGTGGCAGTCCCTCCCAGCAGG - Intronic
1017820019 6:158042530-158042552 GTGTCGCCGCCTGCCCCTGCTGG + Intronic
1019095080 6:169573084-169573106 GTGTTGCAGCCCGAGCCTCCCGG + Intronic
1019432510 7:1005792-1005814 GTGGGGGACCCCGTCCCGGCTGG + Intronic
1019601857 7:1888703-1888725 GTGTGGCTGCCCGTGCATGTGGG + Intronic
1020273082 7:6608256-6608278 GTCGGGCAGCCCCTCCCCGCCGG + Exonic
1020372668 7:7451080-7451102 GTGTGGCTGAAGGTCCCTGCTGG - Intronic
1025249444 7:57342219-57342241 GTGGGGCAGCCCTTCCCTGGGGG - Intergenic
1025739264 7:64182918-64182940 GAGTGCCAGGCCGGCCCTGCGGG - Intronic
1029439888 7:100581819-100581841 GTGTGGCCTCTCTTCCCTGCGGG - Exonic
1029692565 7:102191933-102191955 GTGTGGCAGCCCTTCAGTGGGGG - Intronic
1032077476 7:128842907-128842929 GTGTAGCGGCCCGCCCCTGGTGG - Exonic
1035608411 8:944722-944744 CAGTGGCAGCCAATCCCTGCAGG + Intergenic
1036765638 8:11547852-11547874 GGGGGGCAGCCCATCCCTGGTGG + Intronic
1038228586 8:25679835-25679857 GTTTGCCAGCCCATGCCTGCGGG - Intergenic
1039847189 8:41333953-41333975 GTGGGGCAGCCCCACTCTGCAGG + Intergenic
1039878860 8:41610820-41610842 GTGTGGCAGTCCATGCCTGAAGG + Intronic
1040538359 8:48329183-48329205 GGGAAGGAGCCCGTCCCTGCAGG - Intergenic
1049611080 8:143555630-143555652 GTGTGGCAGCCCGTCCCTGCTGG - Intronic
1049794778 8:144492120-144492142 CTGGGCCAGCCCGTCACTGCCGG + Intronic
1050625908 9:7503449-7503471 GAGTGGCAGCCCTGCTCTGCTGG - Intergenic
1053198271 9:36136462-36136484 GTGGGGAAGCCCGCGCCTGCTGG - Intergenic
1055343303 9:75308597-75308619 GGGTGGCTGCCCCTCCCTCCAGG + Intergenic
1055651358 9:78410090-78410112 GAGTGGCCGGCCGGCCCTGCCGG + Intergenic
1056702807 9:88924944-88924966 GTGAGGCAGCCTGACCCTCCAGG - Intergenic
1056899296 9:90583530-90583552 GCGTGGCGGCCCATCCCTGGTGG - Intergenic
1057680423 9:97176326-97176348 GTGGCTCAGCCCGTCTCTGCTGG - Intergenic
1059023318 9:110599100-110599122 TTGTGGCAGCCCCTCCCCACAGG + Intergenic
1060858382 9:126933812-126933834 GTGTGGCACACCCCCCCTGCAGG - Intronic
1061186772 9:129059547-129059569 GTGTGGCAGCATCTCCCTGATGG + Intronic
1061198313 9:129120960-129120982 GTGTGGCAGCCAGTGCCTCAAGG + Intronic
1061237876 9:129352626-129352648 CTGTGGCAGCACCTGCCTGCGGG + Intergenic
1062137684 9:134938344-134938366 GTGGGGATGCCTGTCCCTGCTGG - Intergenic
1062547525 9:137070383-137070405 GCGCGGCAGCCCCTCCGTGCTGG + Exonic
1203469176 Un_GL000220v1:108737-108759 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1203476997 Un_GL000220v1:152709-152731 GCGTGGCCGCCGGTCCCTCCCGG + Intergenic
1185827744 X:3268690-3268712 CTGCAGCAGCCCATCCCTGCAGG + Intergenic
1196381771 X:115098692-115098714 TGGTGGCAACCCATCCCTGCAGG - Intergenic
1198060899 X:133044469-133044491 GAGTGGCTGGCCGGCCCTGCCGG + Intronic