ID: 1049611081

View in Genome Browser
Species Human (GRCh38)
Location 8:143555636-143555658
Sequence GGGACGGGCTGCCACACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611071_1049611081 30 Left 1049611071 8:143555583-143555605 CCATGGAGGCTGCAGCACAACAG No data
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data
1049611076_1049611081 -8 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG No data
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data
1049611078_1049611081 -9 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611081 8:143555636-143555658 GGGACGGGCTGCCACACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611081 Original CRISPR GGGACGGGCTGCCACACCCC AGG Intronic