ID: 1049611082

View in Genome Browser
Species Human (GRCh38)
Location 8:143555637-143555659
Sequence GGACGGGCTGCCACACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611078_1049611082 -8 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611082 8:143555637-143555659 GGACGGGCTGCCACACCCCAGGG No data
1049611076_1049611082 -7 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG No data
Right 1049611082 8:143555637-143555659 GGACGGGCTGCCACACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611082 Original CRISPR GGACGGGCTGCCACACCCCA GGG Intronic