ID: 1049611083

View in Genome Browser
Species Human (GRCh38)
Location 8:143555643-143555665
Sequence GCTGCCACACCCCAGGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611076_1049611083 -1 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG No data
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611078_1049611083 -2 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611080_1049611083 -10 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC No data
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data
1049611079_1049611083 -9 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA No data
Right 1049611083 8:143555643-143555665 GCTGCCACACCCCAGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611083 Original CRISPR GCTGCCACACCCCAGGGCGC TGG Intronic