ID: 1049611087 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:143555652-143555674 |
| Sequence | CCCCAGGGCGCTGGCTTCCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049611079_1049611087 | 0 | Left | 1049611079 | 8:143555629-143555651 | CCCAGCAGGGACGGGCTGCCACA | No data | ||
| Right | 1049611087 | 8:143555652-143555674 | CCCCAGGGCGCTGGCTTCCAGGG | No data | ||||
| 1049611076_1049611087 | 8 | Left | 1049611076 | 8:143555621-143555643 | CCCTGTTACCCAGCAGGGACGGG | No data | ||
| Right | 1049611087 | 8:143555652-143555674 | CCCCAGGGCGCTGGCTTCCAGGG | No data | ||||
| 1049611080_1049611087 | -1 | Left | 1049611080 | 8:143555630-143555652 | CCAGCAGGGACGGGCTGCCACAC | No data | ||
| Right | 1049611087 | 8:143555652-143555674 | CCCCAGGGCGCTGGCTTCCAGGG | No data | ||||
| 1049611078_1049611087 | 7 | Left | 1049611078 | 8:143555622-143555644 | CCTGTTACCCAGCAGGGACGGGC | No data | ||
| Right | 1049611087 | 8:143555652-143555674 | CCCCAGGGCGCTGGCTTCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049611087 | Original CRISPR | CCCCAGGGCGCTGGCTTCCA GGG | Intronic | ||