ID: 1049611089 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:143555653-143555675 |
Sequence | CCCAGGGCGCTGGCTTCCAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049611080_1049611089 | 0 | Left | 1049611080 | 8:143555630-143555652 | CCAGCAGGGACGGGCTGCCACAC | No data | ||
Right | 1049611089 | 8:143555653-143555675 | CCCAGGGCGCTGGCTTCCAGGGG | No data | ||||
1049611079_1049611089 | 1 | Left | 1049611079 | 8:143555629-143555651 | CCCAGCAGGGACGGGCTGCCACA | No data | ||
Right | 1049611089 | 8:143555653-143555675 | CCCAGGGCGCTGGCTTCCAGGGG | No data | ||||
1049611078_1049611089 | 8 | Left | 1049611078 | 8:143555622-143555644 | CCTGTTACCCAGCAGGGACGGGC | No data | ||
Right | 1049611089 | 8:143555653-143555675 | CCCAGGGCGCTGGCTTCCAGGGG | No data | ||||
1049611076_1049611089 | 9 | Left | 1049611076 | 8:143555621-143555643 | CCCTGTTACCCAGCAGGGACGGG | No data | ||
Right | 1049611089 | 8:143555653-143555675 | CCCAGGGCGCTGGCTTCCAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049611089 | Original CRISPR | CCCAGGGCGCTGGCTTCCAG GGG | Intronic | ||