ID: 1049611092

View in Genome Browser
Species Human (GRCh38)
Location 8:143555667-143555689
Sequence TTCCAGGGGCAGCAGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049611084_1049611092 -3 Left 1049611084 8:143555647-143555669 CCACACCCCAGGGCGCTGGCTTC No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611078_1049611092 22 Left 1049611078 8:143555622-143555644 CCTGTTACCCAGCAGGGACGGGC No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611090_1049611092 -10 Left 1049611090 8:143555654-143555676 CCAGGGCGCTGGCTTCCAGGGGC No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611076_1049611092 23 Left 1049611076 8:143555621-143555643 CCCTGTTACCCAGCAGGGACGGG No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611079_1049611092 15 Left 1049611079 8:143555629-143555651 CCCAGCAGGGACGGGCTGCCACA No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611086_1049611092 -8 Left 1049611086 8:143555652-143555674 CCCCAGGGCGCTGGCTTCCAGGG No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611088_1049611092 -9 Left 1049611088 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data
1049611080_1049611092 14 Left 1049611080 8:143555630-143555652 CCAGCAGGGACGGGCTGCCACAC No data
Right 1049611092 8:143555667-143555689 TTCCAGGGGCAGCAGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049611092 Original CRISPR TTCCAGGGGCAGCAGTGTGT GGG Intronic