ID: 1049612546

View in Genome Browser
Species Human (GRCh38)
Location 8:143562197-143562219
Sequence CCGTGCCCACAGCTGGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 241}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049612537_1049612546 0 Left 1049612537 8:143562174-143562196 CCAGCCAGACTCACCTGCCCTTC 0: 1
1: 0
2: 3
3: 35
4: 375
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612532_1049612546 25 Left 1049612532 8:143562149-143562171 CCCGGGGCACACAAGGCCTGCCC 0: 1
1: 0
2: 0
3: 27
4: 264
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612538_1049612546 -4 Left 1049612538 8:143562178-143562200 CCAGACTCACCTGCCCTTCCCGT 0: 1
1: 0
2: 2
3: 20
4: 264
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612533_1049612546 24 Left 1049612533 8:143562150-143562172 CCGGGGCACACAAGGCCTGCCCA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612534_1049612546 9 Left 1049612534 8:143562165-143562187 CCTGCCCAGCCAGCCAGACTCAC 0: 1
1: 0
2: 7
3: 58
4: 601
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612535_1049612546 5 Left 1049612535 8:143562169-143562191 CCCAGCCAGCCAGACTCACCTGC 0: 1
1: 0
2: 2
3: 38
4: 427
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1049612536_1049612546 4 Left 1049612536 8:143562170-143562192 CCAGCCAGCCAGACTCACCTGCC 0: 1
1: 1
2: 6
3: 43
4: 502
Right 1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049612546 Original CRISPR CCGTGCCCACAGCTGGAGCA GGG Exonic
900420772 1:2555084-2555106 CCCACCCCACAGCTGGAGCCTGG - Intergenic
900421435 1:2557544-2557566 CCTTGCCGACCGCTGGAGCCCGG - Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
901640223 1:10689256-10689278 CCGTGCCCGCTGCCTGAGCAGGG - Intronic
902614507 1:17616444-17616466 CCGTGACAAAAGCAGGAGCAGGG - Intronic
903070347 1:20724090-20724112 CCGAGCCGACAGCTGCAGCTGGG + Exonic
904326291 1:29728807-29728829 CCCTCCCCACAGCTGGTGAAAGG + Intergenic
905058626 1:35120801-35120823 CCGCGGCCAGAGCCGGAGCAGGG + Intergenic
906208156 1:43997843-43997865 CCCTGCCCTCACCTGGAGGAGGG + Exonic
907316832 1:53577614-53577636 CCAGGGCCACAGCTGTAGCAGGG - Intronic
910295082 1:85636413-85636435 GCGTGGCCAGAGCAGGAGCAAGG - Intergenic
911793923 1:102053507-102053529 CCTTGGCCAGAGCTGGAGCTGGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913550883 1:119915887-119915909 GGGTGCCCTCAGCTGGAGCCAGG + Exonic
914756258 1:150563048-150563070 AGGTGCTCACAGCTGCAGCATGG + Intergenic
919647416 1:200108892-200108914 CCCTGCCCACAGCTGACCCAAGG - Intronic
920806864 1:209242934-209242956 CCTTGTCAACAGCTGGAGCAAGG - Intergenic
922725461 1:227920964-227920986 CGGGGCGTACAGCTGGAGCAGGG - Exonic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
924576196 1:245283107-245283129 CCCTGCCACCACCTGGAGCATGG + Intronic
1063251877 10:4282611-4282633 CCGTGACCACATCTGGCTCAGGG + Intergenic
1063755780 10:9006454-9006476 CAGTGCCCAGAGTTCGAGCAGGG + Intergenic
1064012213 10:11743630-11743652 GGGTGCCCACAGCAGGGGCAGGG + Intronic
1067057819 10:43062535-43062557 CCCGGCCCACAGCTCCAGCAAGG + Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1067562756 10:47315277-47315299 CCATGCCCACAGCTGGACCCAGG - Intergenic
1069927394 10:71860336-71860358 CCGGGCCCACAGCTCCATCAGGG + Intergenic
1069957847 10:72062639-72062661 CAGTCCCCCCAGGTGGAGCAGGG + Exonic
1070690424 10:78520909-78520931 ACCTGCCCACAGCTGCAGCCAGG - Intergenic
1072507047 10:96078677-96078699 CCGTGGCCGCAATTGGAGCAAGG - Intergenic
1073119635 10:101113613-101113635 CCGAGCCTACAGCAGGAGAAGGG - Intronic
1073280613 10:102351311-102351333 CCGTGCCCACAAAACGAGCATGG - Exonic
1073527103 10:104193963-104193985 CCGTGCCCACGGCTGCAGAGAGG + Exonic
1075722329 10:124594437-124594459 ACGTGCCCACAGCTACAGAAGGG - Intronic
1075727725 10:124619068-124619090 CCATGGCCACAGCTGCATCATGG - Intronic
1075862675 10:125690670-125690692 CCAGGTCCACAACTGGAGCAGGG - Intergenic
1075929995 10:126287924-126287946 CAGTCCCCACACCCGGAGCAGGG + Intronic
1078496095 11:11818667-11818689 CAGTGCCCAGAGATAGAGCAAGG - Intergenic
1078840910 11:15074901-15074923 CAGTGCCCACAGGTGGACCCTGG + Intronic
1080651150 11:34223582-34223604 CAGTTCCCAGAGCTAGAGCATGG - Intronic
1084301530 11:68255618-68255640 ACGTGCCCACGGCAGGAGCCGGG - Intergenic
1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG + Intergenic
1084404393 11:68962704-68962726 CCTGGCCCGCAGCTGGAGAAGGG + Intergenic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084690032 11:70719753-70719775 CCGTGTCAAATGCTGGAGCAGGG - Intronic
1086377342 11:86214795-86214817 CAGTGCTCACTGTTGGAGCAGGG + Intergenic
1089579183 11:119470863-119470885 CTGTGCCCACAGCTGGGCCGGGG + Intergenic
1091299430 11:134498079-134498101 CCGTGCCCAGGGCTGGAGCGAGG - Intergenic
1091384613 12:85183-85205 GCGTGCCCACAGCTGACGAAAGG + Intronic
1092670172 12:10853450-10853472 CAGTGCTCACAGGTGTAGCAGGG - Intronic
1095705808 12:45235872-45235894 CCCAGCTCACAGCTGGAGGAAGG - Intronic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1096239987 12:49954668-49954690 CAGTGACGACAGCTGGAGCCAGG - Exonic
1097282384 12:57852900-57852922 CTTTGCCCACTGCCGGAGCAGGG - Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1101011420 12:100454226-100454248 CAGGGCCCATAGCTGGAGCCTGG - Intergenic
1102035555 12:109768829-109768851 GCGTGCCTACAGTGGGAGCACGG + Exonic
1102481030 12:113223362-113223384 CAGAGCCCACAGCTTGAGGAAGG + Intronic
1104134980 12:125928819-125928841 CCATGCTCAGAGCTTGAGCAAGG + Intergenic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1106186238 13:27412465-27412487 CCTTGCCTGGAGCTGGAGCAGGG - Intergenic
1107805373 13:44148850-44148872 CAGTACCCAGAGCTGGAGGATGG + Intronic
1108494576 13:51011687-51011709 CCCTGCCCACAGCTTGATCTTGG - Intergenic
1108610131 13:52077221-52077243 CAGTGCCCACTGCTGGAGAGGGG - Intronic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1111649415 13:91070914-91070936 CGGTGCTCACAGCTGGAGGGAGG + Intergenic
1111913663 13:94338911-94338933 CATTGCCCATAGCTGGAGAAGGG + Intronic
1115017410 14:28633840-28633862 CCCTGCTGACAGCTGGACCAGGG - Intergenic
1117722204 14:58638553-58638575 TCGTGCCCGAAGGTGGAGCACGG + Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119521849 14:75292298-75292320 CAGAGCCTTCAGCTGGAGCATGG + Intergenic
1123136327 14:106030836-106030858 AAGTGCCAAAAGCTGGAGCAGGG - Intergenic
1124512570 15:30339675-30339697 CGGTGCCCACAGCTGGGCCTTGG - Intergenic
1124730345 15:32191075-32191097 CGGTGCCCACAGCTGGGCCTTGG + Intergenic
1128084690 15:64877734-64877756 CGCTGGCCACAGCTGGGGCAGGG - Intronic
1129080068 15:73031941-73031963 CCCTCCCCACAGCTGTGGCAAGG + Intergenic
1129681217 15:77659505-77659527 CCATGTCCACAACTGGAACATGG - Intronic
1130085338 15:80773924-80773946 CAGTGCTCACAGCTGGAGGTAGG + Intergenic
1130949413 15:88573687-88573709 CAGTGCCCTCAGCAGCAGCATGG + Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1132495968 16:263585-263607 CCATGGCCACATCTGGACCAGGG - Intronic
1132614143 16:832011-832033 GCGTGCCCTCAGCAGAAGCAAGG + Intergenic
1132726719 16:1342095-1342117 CCGTGCCCTCAGCTTGGTCATGG + Intronic
1132797515 16:1732557-1732579 CGCTGCTCTCAGCTGGAGCAGGG + Intronic
1133302642 16:4792151-4792173 CCAGGCCAAGAGCTGGAGCAGGG + Intronic
1133468988 16:6055736-6055758 CCCAGCACAAAGCTGGAGCAAGG + Intronic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135109333 16:19678446-19678468 CAGTGCCAACAGCTGAAGTAAGG - Intronic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1137722941 16:50638460-50638482 CCCTGCACACATCTGGAGAAGGG - Exonic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1141271717 16:82546989-82547011 TCGTGCCCAGAGCTCAAGCAGGG - Intergenic
1142008923 16:87704036-87704058 CCGTGATCACAGCTAGAGCTCGG + Intronic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142153566 16:88523247-88523269 CAGTGCCCACAGGCAGAGCAGGG + Intronic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143022061 17:3921942-3921964 CCGAGCTCACAGCAGGAGCAGGG - Intergenic
1143518201 17:7430380-7430402 CCATGACCAGTGCTGGAGCAGGG - Intergenic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1144827589 17:18114995-18115017 CAGTGCCCAAAGCTGGATCCTGG + Intronic
1145265199 17:21376628-21376650 CCGTGCTCACAGCCGGACCGAGG + Exonic
1148131812 17:45266772-45266794 TCATGCCCTCAGCTGGAGGAGGG + Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148700492 17:49583863-49583885 CCCTGTCCACACCAGGAGCAAGG - Intergenic
1149557701 17:57585875-57585897 TCGTGTGCGCAGCTGGAGCAAGG - Intronic
1151404416 17:73877481-73877503 TCCTGGCTACAGCTGGAGCAAGG + Intergenic
1151930688 17:77229849-77229871 ATGTGCCCACAGCTGGGACAAGG + Intergenic
1152247190 17:79191201-79191223 CCTTGCCCAGTGCTGGAGGAAGG - Intronic
1152570052 17:81117743-81117765 CCGTGGCCACAGCGGGACCCAGG + Exonic
1152740114 17:82015029-82015051 CCGTCCCCCCAGCCAGAGCAGGG - Intronic
1153842346 18:9018007-9018029 CCGTGCCCACAGGAAGAGCTGGG + Intergenic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1157403328 18:47404143-47404165 CCGTGCCCACCACTGGGTCAGGG - Intergenic
1158517667 18:58144341-58144363 ACGTGGCCAGAGCAGGAGCAAGG + Intronic
1160299550 18:77667720-77667742 CCGTGCTGACAGCTGTTGCAGGG - Intergenic
1160406134 18:78647433-78647455 CGGGGACCACAGATGGAGCAGGG - Intergenic
1160779716 19:872421-872443 CCGGGCCCGCAGCTGTAGGAGGG - Intronic
1161061980 19:2219833-2219855 CCCTCCCCACAGCTGGACCCCGG + Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1166715184 19:44962442-44962464 CCCTGCCCACAGCTGGATCCTGG - Intronic
1168469590 19:56629548-56629570 CTGTGCCCACACATGGAGGAAGG - Intergenic
925010346 2:480420-480442 CCCTGCTCCCAGGTGGAGCAAGG + Intergenic
926121252 2:10242290-10242312 CCGTGCCCACCTCTGCAGAAAGG - Intergenic
926197841 2:10774470-10774492 CCGTCACCACAGCTGGCACAGGG - Intronic
927247098 2:20965849-20965871 CAGTGCCCAGAGCTGGTGCTGGG + Intergenic
927516157 2:23672731-23672753 CCGGGCCGACACCTGGAGCTGGG - Intronic
933941592 2:87249570-87249592 CCGTGCTCCCAGCTGCAACATGG - Intergenic
935271241 2:101436050-101436072 GGGTGCCCACAGATGCAGCAGGG - Intronic
936815632 2:116456939-116456961 CCTTGGCCACAGCTGGGGAAGGG - Intergenic
937041954 2:118829421-118829443 CCAGGACCACAGCTGCAGCAGGG + Intergenic
937280256 2:120712793-120712815 CTGTGCCAACACCTGGAGCCAGG + Intergenic
937315707 2:120930869-120930891 CCCTACCCAGAGCTGGAGCATGG - Intronic
937871992 2:126792588-126792610 CCATGCTCACACCTAGAGCAAGG - Intergenic
941670100 2:168283950-168283972 CCGTCCCTCCAGCTTGAGCATGG - Intergenic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
947935041 2:233997429-233997451 CAGTCCCCACAGCTGGTGAATGG - Intronic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
948777347 2:240296667-240296689 CCGTTCCCACTGCTGGGGCAGGG + Intergenic
948835168 2:240622875-240622897 CCGTGCCCACAGCAGGACCCTGG + Intronic
949039837 2:241843131-241843153 CCGTGTCCACCGCCGGAGGAAGG - Intergenic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169210780 20:3765246-3765268 CTGTGGACACAGCTGCAGCAGGG - Intronic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1171383114 20:24748075-24748097 CCCTGCCCACACCTGGACCTGGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172694536 20:36813003-36813025 CAGTGCCCCCAGCTGGGGCTGGG - Intronic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1173721809 20:45265196-45265218 CTGTGCCCAAAGCTGGGGTAAGG + Intergenic
1173741834 20:45407014-45407036 CGGAGCCCAGAGCTGGAGAAAGG - Intronic
1176122527 20:63460499-63460521 CAGTGCCCTCAGCTGGTCCACGG + Intronic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1180007890 21:45031687-45031709 CCGTGCCCTCAGCTCCAGCCAGG + Intergenic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181010127 22:20035392-20035414 CAGTGCTCACAGCTGGGACATGG - Intronic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1182062292 22:27406871-27406893 CCTTGCTCACATCTGGAGCAGGG - Intergenic
1183655954 22:39184839-39184861 CTGTGCCCACTCCTGCAGCAAGG + Intergenic
1183662522 22:39230024-39230046 CCCTGCCCCCAGCTGCTGCAGGG + Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184248810 22:43248929-43248951 CCTTGCCCAGAGCGGGAGCATGG - Intronic
1184778345 22:46634282-46634304 CCCTGCCCACAGCGGTTGCAAGG - Intronic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
1185071391 22:48658673-48658695 CCAAGCCCACAGCTGGAGAGTGG + Intronic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
1185248293 22:49785218-49785240 GGGAGCCCACAGCTGGGGCAGGG + Intronic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
949979742 3:9494603-9494625 CCTTGCCCACTGCTGGTTCACGG + Intergenic
950017721 3:9765970-9765992 CTGTGACCACTGCTGGACCAAGG + Exonic
951389832 3:22089495-22089517 CCATGCACACTGCTGGAGCCAGG - Intronic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954409264 3:50363234-50363256 CCATGCCCACTGCTGGTGCCAGG - Intronic
954449766 3:50565531-50565553 CCGTGCCACCAGCTGCATCAGGG + Exonic
954670348 3:52287835-52287857 CGGTGCCCAGCGCTGGAGAACGG - Exonic
955225036 3:57053320-57053342 CGCTGCCCACACCTGGGGCAGGG + Intronic
958026708 3:88058576-88058598 CCGGGCCCACAGCTGGCACCTGG - Intronic
959632099 3:108518379-108518401 CCCTGCCAACATCTGGATCAAGG + Intronic
960528260 3:118734917-118734939 CCCTGCCCACAGCTGCAGTCAGG + Intergenic
961144720 3:124584577-124584599 TCCTGCCCACAGCTGGACCTTGG + Intronic
961333496 3:126156597-126156619 CGGAGCCCACAGCTGCAGGAGGG - Intronic
961450148 3:126999034-126999056 ACCTGTCCACAGCTGGAGGAGGG + Intronic
961756286 3:129128974-129128996 CCGTGGCCACAGCTGTAGACAGG - Intronic
962742309 3:138370613-138370635 CCGGGGCCACAGCTGGAACCTGG + Intronic
963253310 3:143120899-143120921 CCGGGGCCACTGCGGGAGCAGGG - Exonic
966177171 3:177151353-177151375 TGGTGCCCACAGCTGCAGCCGGG - Intronic
967564432 3:190957445-190957467 CTGTGCCTACAGCTTGAGAAAGG + Intergenic
967790041 3:193538929-193538951 TTGTGCCCCAAGCTGGAGCACGG + Intronic
968946017 4:3664702-3664724 CCGTGCTCAGAGCTGGGACATGG + Intergenic
969057718 4:4412555-4412577 CCTTGGCCAAAGCTGGAGAAAGG + Intronic
969136472 4:5033253-5033275 CGGCGTCCACAGCTGCAGCACGG + Intergenic
971246835 4:24936992-24937014 CCGTGCCCATGGCTGAAGAATGG + Intronic
971460965 4:26896021-26896043 CCATGTCCTCATCTGGAGCATGG + Intronic
972169942 4:36333762-36333784 CCGTGCCCACAGAAGGAGTGTGG + Intronic
975118523 4:70705029-70705051 CCGTGCCCCCGGCGGGAGCGCGG - Intronic
976838902 4:89408053-89408075 CCCTGCCCACAGCTGGAGATTGG + Intergenic
977562103 4:98543060-98543082 CCATGCACACAGCACGAGCAGGG + Intronic
981938592 4:150258388-150258410 CTAGGCCCACAGCTGTAGCAGGG + Intergenic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
987243430 5:16024381-16024403 CCATGGCCAGAGCAGGAGCAAGG - Intergenic
995490857 5:112690372-112690394 CAGTGCCCACAGCCTGAACATGG - Intergenic
998658128 5:144205225-144205247 GCGTGCCCACCGCCGGAGCGCGG + Intronic
999271086 5:150296759-150296781 CCTGGCCCCCAGCTGAAGCATGG - Exonic
1001471962 5:172020817-172020839 CCTTGGCCACAGCTGGAGAAAGG + Intergenic
1001912810 5:175534857-175534879 CAGTGCCCACAGAAGCAGCATGG + Intergenic
1003136147 6:3435960-3435982 CCCTGCCCACACCTGGATCTAGG + Intronic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1004858986 6:19781765-19781787 AGGTCACCACAGCTGGAGCAGGG - Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1005453110 6:25992754-25992776 CCGTTCTCACAGCTGGATCTGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007665959 6:43513072-43513094 CAGTGCCAACATCTGCAGCATGG + Exonic
1013978749 6:116105196-116105218 GCCTGCACACAGCTGGAGTAGGG - Intronic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1015569149 6:134604181-134604203 CCAGGCCCACGACTGGAGCAAGG + Intergenic
1017770231 6:157638912-157638934 CAGCGCCCACAGCCTGAGCAAGG + Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019363677 7:619269-619291 CCCTGCCCACATCTTGAGCTTGG + Intronic
1019411445 7:908491-908513 CCGTGCGCACAGCAGCAGCCAGG + Intronic
1019477582 7:1251467-1251489 CCCTGCCCACACCTGGATCTCGG + Intergenic
1019649036 7:2146602-2146624 CCGTGACCTCAGCTGGACCAGGG + Intronic
1019684147 7:2371239-2371261 GCGTTCCCACAGCTGGTCCACGG + Intronic
1019799857 7:3080264-3080286 CCGGGCTCTCTGCTGGAGCATGG - Intergenic
1022472070 7:30688258-30688280 CCCTGCCCACAGCTTGATCTTGG + Intronic
1022962696 7:35444785-35444807 CATTGCCCACAGCTGGTCCAAGG - Intergenic
1023996461 7:45161826-45161848 CAGTGCCCACACCTGCAGCCTGG - Intronic
1024675250 7:51632277-51632299 CCAGGAACACAGCTGGAGCAGGG + Intergenic
1028370582 7:90087334-90087356 CCGTGGCCAGCGCTTGAGCAAGG + Intergenic
1030007414 7:105132799-105132821 CCCTGCGGACATCTGGAGCACGG - Exonic
1032552466 7:132797196-132797218 CCCTGCACACAGCTGAAGCCTGG + Intronic
1034061627 7:148097019-148097041 CTGTGCCCATTCCTGGAGCATGG - Intronic
1044846699 8:96389036-96389058 CCATGGCCACAGCTGGAAAAAGG - Intergenic
1045877231 8:106996367-106996389 ACGTGCCCACATCTGGTCCATGG + Intergenic
1046134008 8:110003541-110003563 ATGTGCCCAGAGCAGGAGCAAGG + Intergenic
1046611386 8:116429461-116429483 CCATGGCCACAGCAGGAGGAAGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1049182173 8:141228533-141228555 CACTCCCCGCAGCTGGAGCATGG + Exonic
1049207773 8:141371401-141371423 CCCTGGCCACAGCTGGCACAAGG + Intergenic
1049355505 8:142186344-142186366 CCATGCCCCCAGCAGGAGCATGG + Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1049657292 8:143804515-143804537 CAGTGCCCACAGCTGAAGCTGGG + Intronic
1050243072 9:3658706-3658728 TCCTGCCCACACCAGGAGCAAGG - Intergenic
1055638317 9:78298524-78298546 ACATCTCCACAGCTGGAGCAGGG - Intronic
1056679253 9:88702814-88702836 CCTTGACCACTGCTAGAGCATGG + Intergenic
1057891562 9:98873924-98873946 CCATGCCCACCTTTGGAGCAGGG + Intergenic
1059283098 9:113151204-113151226 CATTGCCAACAGCTGGAACAGGG + Intronic
1059418750 9:114178190-114178212 CCATGCCCACAGCTGCAGGCGGG + Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060814523 9:126627582-126627604 CTTTCCCCAGAGCTGGAGCAGGG + Intronic
1060827025 9:126693392-126693414 CCCTACCCCCAGCAGGAGCAGGG - Intronic
1061374363 9:130215333-130215355 CCCTTCCCACAGCAGGAGGAAGG - Intronic
1061471926 9:130834060-130834082 CCTTGCCCACAGCTGGAAACAGG - Intronic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1185746097 X:2574688-2574710 CCCTGCCCACACCTGGATCTCGG + Intergenic
1186371672 X:8953245-8953267 CCCTGCCCACACCTGGATCTCGG - Intergenic
1186509059 X:10117057-10117079 CCGTGCTCACAGGGTGAGCAGGG + Intronic
1189714698 X:43853408-43853430 CAATGCCCTCAGCTAGAGCAAGG + Intronic
1190017119 X:46836723-46836745 CCCCGCCCACAGCTGTGGCACGG - Intergenic
1190098293 X:47500384-47500406 CAGTTCCCAGGGCTGGAGCAAGG + Intergenic
1190455802 X:50626825-50626847 GCCTGCCCACAGCTTGAGCAGGG - Intronic
1195466387 X:105183574-105183596 CCCTGCCCACACCAGCAGCAGGG - Intronic