ID: 1049613811

View in Genome Browser
Species Human (GRCh38)
Location 8:143567754-143567776
Sequence GCCAGGGGCAGTGTGACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 380}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049613792_1049613811 23 Left 1049613792 8:143567708-143567730 CCACAGCCCCCCAGGGGGAGGCT 0: 1
1: 2
2: 8
3: 52
4: 463
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613789_1049613811 25 Left 1049613789 8:143567706-143567728 CCCCACAGCCCCCCAGGGGGAGG 0: 1
1: 0
2: 2
3: 34
4: 466
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613805_1049613811 -9 Left 1049613805 8:143567740-143567762 CCCAAAGCCCCGGTGCCAGGGGC 0: 1
1: 0
2: 1
3: 29
4: 243
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613801_1049613811 -3 Left 1049613801 8:143567734-143567756 CCAGCTCCCAAAGCCCCGGTGCC 0: 1
1: 0
2: 1
3: 22
4: 283
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613796_1049613811 15 Left 1049613796 8:143567716-143567738 CCCCAGGGGGAGGCTGGCCCAGC 0: 1
1: 0
2: 8
3: 58
4: 603
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613794_1049613811 17 Left 1049613794 8:143567714-143567736 CCCCCCAGGGGGAGGCTGGCCCA 0: 1
1: 0
2: 3
3: 25
4: 271
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613806_1049613811 -10 Left 1049613806 8:143567741-143567763 CCAAAGCCCCGGTGCCAGGGGCA 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613798_1049613811 13 Left 1049613798 8:143567718-143567740 CCAGGGGGAGGCTGGCCCAGCTC 0: 1
1: 0
2: 10
3: 37
4: 396
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613795_1049613811 16 Left 1049613795 8:143567715-143567737 CCCCCAGGGGGAGGCTGGCCCAG 0: 1
1: 0
2: 3
3: 39
4: 441
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613797_1049613811 14 Left 1049613797 8:143567717-143567739 CCCAGGGGGAGGCTGGCCCAGCT 0: 1
1: 0
2: 5
3: 46
4: 320
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613791_1049613811 24 Left 1049613791 8:143567707-143567729 CCCACAGCCCCCCAGGGGGAGGC 0: 1
1: 0
2: 4
3: 17
4: 295
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380
1049613800_1049613811 -2 Left 1049613800 8:143567733-143567755 CCCAGCTCCCAAAGCCCCGGTGC 0: 1
1: 0
2: 1
3: 20
4: 159
Right 1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG 0: 1
1: 0
2: 3
3: 26
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049613811 Original CRISPR GCCAGGGGCAGTGTGACCCC GGG Intronic
900096777 1:943001-943023 CCCAGGGGCAGTGTGGACCCTGG - Exonic
900124364 1:1062925-1062947 GCCAGGGGCTGTGGGGTCCCAGG - Intergenic
901051202 1:6426661-6426683 CCCAGAGCCAGTGGGACCCCTGG + Intronic
901060264 1:6468594-6468616 GCCAGGAGCAGAGTCAGCCCAGG + Intronic
901061040 1:6472012-6472034 GACCAGGGCAGTGTGACCTCGGG - Intronic
902261349 1:15227083-15227105 TCCAGGGGCTGCGTGTCCCCTGG - Intergenic
902394923 1:16127443-16127465 GACAGTGGCTGTGGGACCCCAGG + Intronic
902404679 1:16176087-16176109 CCCAGGCGGAGTGTGACCGCGGG - Intergenic
902840474 1:19070971-19070993 GGCAGGGGCAGAGAGAGCCCCGG + Intergenic
903349712 1:22710599-22710621 GCCCGGGCCACTGAGACCCCGGG - Intergenic
903778695 1:25808683-25808705 GCCAGGAGCTGGGTGAGCCCTGG + Exonic
904212976 1:28897910-28897932 GCCATGTGCAGAGTGAGCCCAGG + Intronic
904477970 1:30776805-30776827 GCAGGGGGCAGTGAGATCCCTGG - Intergenic
905295851 1:36953969-36953991 GCCAAGGGCAGTCTGACTGCAGG - Intronic
905883550 1:41479604-41479626 CCCAGGGCCGCTGTGACCCCAGG - Intronic
905933202 1:41804230-41804252 GGCAGGGGCTGTGGGACCACTGG - Intronic
906229919 1:44153324-44153346 GGCAGGGTCAGTATGGCCCCTGG - Intergenic
906562371 1:46768579-46768601 CCCACTGGCAGTCTGACCCCTGG - Intronic
906623636 1:47306753-47306775 GCCAGGGGCAGTGTAAAGCAAGG + Intronic
906685685 1:47761701-47761723 AGCAGGGGCAGTGTGCCCACTGG - Exonic
906809328 1:48810177-48810199 CACAGGGGCTGTGTGTCCCCAGG - Intronic
907269912 1:53284903-53284925 GCCAGTAGCTGTGTGACCCTAGG - Intronic
908935725 1:69373746-69373768 GCCAGTGGCAGTGTCAGCACAGG + Intergenic
909076288 1:71053951-71053973 GCCAAGGGCAGTGAGAACCCCGG + Intergenic
909484683 1:76159531-76159553 GCCAGAAGCAGGCTGACCCCAGG - Intronic
912487825 1:110043041-110043063 GCCAGGGTCAATGTGTCCACAGG - Intronic
912717188 1:111990686-111990708 GTTAGAGGCAGTGTGTCCCCCGG - Intergenic
915073666 1:153292423-153292445 GCCAGGGGCAGGGTGGCTCTGGG - Intergenic
915106807 1:153539943-153539965 GCCAGGGGCAGGGTGGCCAAGGG - Intronic
916379012 1:164188202-164188224 CCCAGGGGCACTGTGGTCCCTGG - Intergenic
916558012 1:165909786-165909808 GCCAGGGGCCCTGTGTCCTCAGG - Intronic
918444707 1:184605681-184605703 GGCAGCAGCTGTGTGACCCCAGG + Intronic
919914214 1:202130021-202130043 GCCGGGGGCAGTGGGAGCTCTGG - Exonic
920700794 1:208216949-208216971 GCCTGGGCCAGTGAGTCCCCAGG + Exonic
920701216 1:208219249-208219271 GCCAGGGGCAGTCTGGGCCAGGG + Intronic
921861400 1:220046100-220046122 GGGAGGCGCAGTGTGAGCCCGGG - Intronic
922037045 1:221858963-221858985 GCCAAGGGCTGTGTCATCCCTGG + Intergenic
922614827 1:226955506-226955528 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614835 1:226955538-226955560 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614845 1:226955569-226955591 GCCAGGGAGAGTGTGAACCCAGG - Intronic
922614850 1:226955599-226955621 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614883 1:226955709-226955731 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614891 1:226955741-226955763 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614899 1:226955771-226955793 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614907 1:226955803-226955825 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614915 1:226955833-226955855 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614921 1:226955865-226955887 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614951 1:226955989-226956011 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614959 1:226956021-226956043 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922614975 1:226956085-226956107 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615007 1:226956227-226956249 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615015 1:226956259-226956281 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615022 1:226956291-226956313 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615028 1:226956323-226956345 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615063 1:226956465-226956487 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615071 1:226956497-226956519 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615079 1:226956527-226956549 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615087 1:226956559-226956581 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615095 1:226956589-226956611 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615101 1:226956621-226956643 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615112 1:226956667-226956689 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615120 1:226956699-226956721 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615127 1:226956729-226956751 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615134 1:226956759-226956781 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615148 1:226956821-226956843 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615154 1:226956853-226956875 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615162 1:226956885-226956907 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615170 1:226956915-226956937 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615176 1:226956947-226956969 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615187 1:226956993-226957015 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615207 1:226957085-226957107 GCCAGGGAGAGTGTGAACCAGGG - Intronic
922615213 1:226957117-226957139 GCCAGGGAAAGTGTGAACCAGGG - Intronic
922769665 1:228175151-228175173 TCCAGGGGCAGGGCCACCCCAGG - Exonic
924707774 1:246512735-246512757 GCTAAGGGCAGTGTGTCCGCTGG - Intergenic
1062802130 10:388627-388649 GCAGGGGGCAGTGCGTCCCCAGG + Intronic
1066037565 10:31508685-31508707 GGCAGGGGCAGGATGATCCCAGG + Intronic
1067062068 10:43082661-43082683 CTGAGGGGCAGTGTGGCCCCAGG + Intronic
1067832966 10:49620946-49620968 GCCTGGGGCAGTGTTTCCCAGGG - Intronic
1071568867 10:86685607-86685629 ACCAGGGGCAGTTTGAGCGCCGG - Intronic
1073477884 10:103766258-103766280 TCCAGGGCCAGTCTGAGCCCGGG + Intronic
1074570331 10:114618565-114618587 CCCAGGGGCAGTGTGCTTCCAGG - Intronic
1076357980 10:129866770-129866792 GCTAGGGGCCGTGTGTCCACCGG - Intronic
1077096017 11:799480-799502 GCCAGGGGCTGTGGGGCTCCTGG - Exonic
1077110248 11:859101-859123 GCCAGGGCACGTGTGAGCCCGGG - Intronic
1077362552 11:2147143-2147165 GCTGGGGGCTGTGAGACCCCCGG - Intronic
1077377304 11:2211069-2211091 GCACAGGGCAGTGTGTCCCCAGG - Intergenic
1078416450 11:11170142-11170164 GCCAGGGGAAGAGTGGGCCCAGG + Intergenic
1079315219 11:19402115-19402137 GTCAGGAGCTGTGTGACCCTGGG - Intronic
1081534430 11:43986957-43986979 GCCAGAGACAGTGTGATTCCAGG + Intergenic
1081637106 11:44728011-44728033 GGCCGGGGCAGTGCGCCCCCTGG - Intronic
1081853774 11:46291221-46291243 ACCTTGGGCTGTGTGACCCCAGG + Intronic
1081973290 11:47214832-47214854 GCCAGGGCCAGTGCCAGCCCGGG - Intronic
1083692616 11:64419553-64419575 GCCTGGCGCTGTGTGAGCCCGGG + Intergenic
1084453266 11:69252384-69252406 GCCAGGCTCTGTGTGACTCCCGG - Intergenic
1084760240 11:71266250-71266272 GCCAGGTGCAGTTTGAGGCCAGG - Intergenic
1084772023 11:71349577-71349599 GCCAGGGGCTGTGCCCCCCCAGG + Intergenic
1085145427 11:74191678-74191700 GCCTGGGGCATTTTGAGCCCTGG - Intronic
1088363829 11:109018318-109018340 GCTAAGGGCTGTGTGACCTCGGG + Intergenic
1089254443 11:117186878-117186900 GCCTTGGGCAGTGTGGCCCACGG + Intronic
1091447428 12:551978-552000 GCCAGGGGCAGGCTTAACCCTGG + Intronic
1092754866 12:11753716-11753738 GCCGGCGGCAGTGTTCCCCCAGG - Intronic
1096155106 12:49337221-49337243 GCCAGAGGCGGAGCGACCCCTGG + Intergenic
1096215412 12:49795492-49795514 GGCAGGGGCCCTGTGCCCCCAGG - Exonic
1097270165 12:57769184-57769206 GCCAGGGGCAGTCTGAACAGTGG - Intronic
1098944342 12:76573508-76573530 GCCAGGGGCAGAGCTACCCAAGG - Intergenic
1101563157 12:105879436-105879458 GGCTGGGGCAGAGTGACCCAGGG + Intergenic
1102490837 12:113288726-113288748 GACAGGGGCAGGGTGACGCGGGG - Intronic
1103724381 12:122990488-122990510 GCCAGGGCCATTGTGCCCACAGG - Intronic
1104144642 12:126020860-126020882 GCCAGGGGCTTTGTGAGCCATGG - Intergenic
1104774827 12:131384904-131384926 GCCAGAGGCTGTGGGAGCCCAGG + Intergenic
1105432005 13:20345188-20345210 GGCCTGAGCAGTGTGACCCCTGG + Intergenic
1105694304 13:22872728-22872750 GCCAGGGCCACTGTGACCTGTGG + Intergenic
1105887194 13:24652178-24652200 GACAGGGGCGGTGTGAGACCAGG + Intergenic
1106809850 13:33349525-33349547 GCAAGGGGCAGTGTGACACTGGG + Intronic
1109780652 13:67106790-67106812 GCCAGGGGCAGGGAGAGGCCAGG - Intronic
1111765744 13:92526336-92526358 GCCAGGAGCACTCTGACCTCAGG - Intronic
1112784569 13:102937949-102937971 GGCAGGGGTAGTGGGTCCCCAGG + Intergenic
1113197289 13:107823372-107823394 GCCAGGGGCAGAGGGGCTCCTGG - Intronic
1113452901 13:110424739-110424761 GCCTGGGCCAGTGGGCCCCCAGG + Exonic
1113464442 13:110503908-110503930 ACCAGGGACAGTGGGTCCCCAGG + Exonic
1114073144 14:19131621-19131643 ACCAGGGGCAGTGTGCCCAGTGG - Intergenic
1114089122 14:19268362-19268384 ACCAGGGGCAGTGTGCCCAGTGG + Intergenic
1118216016 14:63809058-63809080 GCCAAGTTCAGTGTGACCTCCGG - Intergenic
1119933533 14:78569939-78569961 GCCACTGCCAGTGTGGCCCCTGG - Intronic
1121241187 14:92431033-92431055 GCCTGGAGCAGTGTAATCCCAGG - Intronic
1121263153 14:92581202-92581224 GCCGGGGGCTGTGTGACCCCAGG - Intronic
1121311779 14:92939271-92939293 GCCAGGGACAATGTGACCGAAGG + Exonic
1122056325 14:99100788-99100810 GGCAGGGAGAGTGGGACCCCAGG - Intergenic
1122140235 14:99659308-99659330 GCCAGGTGCAGGGTGAGCCTAGG - Intronic
1122399134 14:101457369-101457391 GCCCGGAGCCGCGTGACCCCGGG - Intergenic
1122961608 14:105096426-105096448 GCCAGGTGGGGTGTGGCCCCTGG - Intergenic
1123926348 15:25115427-25115449 CCCAGTCACAGTGTGACCCCAGG + Intergenic
1124135180 15:27028963-27028985 GCCGGGGGCATTGTAAGCCCTGG + Intronic
1125630291 15:41141769-41141791 GCCAGGTGCAGTGCCTCCCCCGG + Intergenic
1126548781 15:49904011-49904033 GTCAGAGGCAGTCTGAACCCAGG - Intronic
1128665752 15:69537341-69537363 GCCAGGCCCAGTGGGACTCCAGG + Intergenic
1129172439 15:73816490-73816512 TCCTGGGCCAATGTGACCCCAGG + Intergenic
1129244104 15:74269376-74269398 GCCAGGGACACTGAGACCCAAGG + Intronic
1129678425 15:77644628-77644650 CCCAGGGGCAGGCTGAGCCCGGG + Intronic
1130235525 15:82130004-82130026 GGCAGAGACAGTGTGAGCCCCGG + Intergenic
1130984236 15:88834358-88834380 GGCAGGGGCAGGGTGGGCCCAGG - Intronic
1131268016 15:90930127-90930149 GCCCGGGGCTGTCCGACCCCGGG - Exonic
1131558658 15:93420596-93420618 GCCAGGGGCAGGGGAACCACTGG + Intergenic
1131658313 15:94485209-94485231 GGCAGGGGCGGTGTGACCCCAGG - Intergenic
1132673517 16:1112320-1112342 TCCTGGGACAGTGTCACCCCCGG + Intergenic
1132767139 16:1540083-1540105 GCGAGGAGCAGTGTGCCTCCAGG + Intronic
1133191088 16:4134102-4134124 GCAAGAGGCACTGTGACCCTCGG - Intergenic
1133237164 16:4392712-4392734 GCCAGGGCCGGTGTGAGCCGAGG - Intronic
1136029201 16:27490440-27490462 GCCCGGGGCAGTGGGAGCTCAGG + Intronic
1136246190 16:28977609-28977631 GACAGGGGCATTGTGAGCCATGG + Intronic
1137394360 16:48106433-48106455 GCCAATGGCAGTGGGACTCCTGG + Intronic
1137937397 16:52647613-52647635 GCCAGTAGGGGTGTGACCCCTGG + Intergenic
1138528643 16:57622923-57622945 GGCAGGGACAGGGTGACCCTGGG + Intronic
1138590289 16:57995937-57995959 GCCAGGGGCGACGTGTCCCCAGG - Exonic
1139431641 16:66913913-66913935 GCCATGGGGATTGTCACCCCGGG - Intronic
1140218736 16:73028440-73028462 GCCCGGGGCAGTGTGATGCTGGG + Intronic
1141548718 16:84789824-84789846 GCCAGGGTGACTGTGTCCCCAGG - Intergenic
1141624510 16:85254211-85254233 CCAACGGGCTGTGTGACCCCAGG - Intergenic
1141648202 16:85378494-85378516 CCCAGGGCCAGAGAGACCCCAGG + Intergenic
1141721765 16:85759875-85759897 GGCATGGGCAGTGTGATCCTCGG + Intergenic
1141801946 16:86315713-86315735 GCCTGGGGCATTGTCAGCCCAGG - Intergenic
1142033634 16:87850745-87850767 GCCAAGGACAGTGTGTCCCAGGG + Intronic
1142215094 16:88826147-88826169 GACAGGGGCAGCGTGTGCCCGGG + Intronic
1142262084 16:89047851-89047873 GAGAGGAGCAGTGAGACCCCAGG + Intergenic
1142284877 16:89167621-89167643 GCAGGGGGCAGTGTGGCTCCAGG - Intergenic
1142286946 16:89175332-89175354 GCATGGGGCAGGGAGACCCCAGG - Intronic
1142400478 16:89855853-89855875 GCCCGGGGCTGTGTGGCCCTGGG + Intronic
1142433099 16:90040975-90040997 GCCAGAGGCACTGTGGCCCCGGG + Intronic
1142441691 16:90102573-90102595 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
1143205381 17:5136954-5136976 GCAAAGGGCAGTGTGTCCACCGG + Intronic
1143579984 17:7819763-7819785 ACCAGGAGCAGTGGCACCCCTGG - Intronic
1144659773 17:17060437-17060459 GCCAGGGCCAGTGTGGAACCAGG + Intronic
1144718408 17:17450562-17450584 GCCAGGAGCAGTGGCAGCCCAGG - Intergenic
1144753290 17:17664839-17664861 TCCATGGGCAGTGGCACCCCGGG - Intergenic
1144833375 17:18143932-18143954 TCCAGGGGCAGTGTGACACGGGG - Exonic
1144942778 17:18952869-18952891 TCCAGGGGCAGCGGGGCCCCTGG + Intronic
1146054804 17:29575741-29575763 GCTAGGGGCAGTGTGGGTCCAGG - Intronic
1146161133 17:30559949-30559971 GCTAAGGGCAGTGTGTCCACCGG + Intronic
1146738078 17:35256831-35256853 TCCAGGGCCAGGGGGACCCCTGG - Intronic
1146843242 17:36168838-36168860 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1146855552 17:36256779-36256801 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1146865069 17:36331596-36331618 GCAAAGGGCAGTGTGTCCACCGG + Intronic
1146871458 17:36380690-36380712 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1146878817 17:36431772-36431794 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1146882761 17:36452918-36452940 GCAAAGGGCAGTGTGTCCACCGG - Intergenic
1146945375 17:36869860-36869882 CTCAGGGGCAGACTGACCCCCGG - Intergenic
1147067928 17:37932190-37932212 GCAAAGGGCAGTGTGTCCACCGG + Intronic
1147074344 17:37981314-37981336 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1147079459 17:38011745-38011767 GCAAAGGGCAGTGTGTCCACCGG + Intronic
1147085866 17:38060852-38060874 GCAAAGGGCAGTGTGTCCACCGG - Intronic
1147095400 17:38135687-38135709 GCAAAGGGCAGTGTGTCCACCGG + Intergenic
1147101813 17:38184818-38184840 GCAAAGGGCAGTGTGTCCACCGG - Intergenic
1147119589 17:38328156-38328178 GCCAGGTGAAGTGTGTCCCTGGG - Exonic
1147265544 17:39232219-39232241 GCAGGGGGCAGTGTGGGCCCAGG - Intergenic
1148679944 17:49467850-49467872 GCCAGAGTCTATGTGACCCCTGG - Intronic
1150103965 17:62448101-62448123 GCCCGGGTCAGGGTGAACCCTGG + Intronic
1151726925 17:75890805-75890827 GCCAGGGGCTGTGTTCCCTCTGG - Exonic
1151880011 17:76889181-76889203 CGCAGGGGCAGTGTCAGCCCTGG + Intronic
1151970691 17:77456079-77456101 GCCACGGGCAGTGTTTCCTCCGG - Intronic
1152477303 17:80526612-80526634 GCCAGGGGCAAGGAGACCTCGGG - Intergenic
1152676646 17:81644817-81644839 GCCAGGGGCAGGGGGCCCTCAGG - Intronic
1152747887 17:82049597-82049619 GGCCGGGGCAGTGGGGCCCCTGG + Intronic
1152805493 17:82353922-82353944 CCCAGGGGCAGTGTTTCCACAGG + Intergenic
1155114622 18:22752148-22752170 GGCAGTGGCAGGGTAACCCCAGG - Intergenic
1156475345 18:37402417-37402439 TCCAGGGTCAGGGGGACCCCAGG + Intronic
1159713845 18:71797385-71797407 GTCATGGGCAGTGAGACCCAAGG - Intergenic
1160165368 18:76506805-76506827 GCCAGTGGCTGTGCCACCCCGGG + Intergenic
1160392099 18:78541603-78541625 GCCAGGGCCAGGATGACACCAGG + Intergenic
1161101548 19:2424371-2424393 GCCTGGGGCAGTGGGAGCCGGGG - Intronic
1161162454 19:2768804-2768826 GCCGGGGGCTGTGTGGCCCTGGG + Intronic
1161302862 19:3551430-3551452 GCCAGGCGCAGGGGGTCCCCCGG + Intronic
1161482301 19:4517173-4517195 CCCCTGGGCTGTGTGACCCCAGG + Intronic
1161501771 19:4620151-4620173 GCCAGGTGCTGTGTGACCTCGGG - Intergenic
1161571540 19:5033311-5033333 CCCAGGGGCAGTGGGCCACCAGG + Intronic
1161620902 19:5296628-5296650 GCCAGGTGCAGTGCTGCCCCGGG - Intronic
1162344186 19:10110252-10110274 GCCCAGGGCAGGGGGACCCCCGG + Intronic
1162439404 19:10683307-10683329 TCCAGGGGCAGGGGGACCCCAGG - Intronic
1162737253 19:12753553-12753575 TCAGGGGGCACTGTGACCCCAGG - Intronic
1163053258 19:14700768-14700790 CCCAGGGTCAGTGAGAACCCCGG + Intronic
1164748519 19:30634011-30634033 GGCAGGGGCAGTGTCACTTCAGG - Intronic
1166231692 19:41428403-41428425 CCCAGCGGCACTGTGACTCCAGG + Intronic
1166350846 19:42197377-42197399 GCCAGCTGCTGTGTGATCCCAGG - Intergenic
1166360282 19:42250265-42250287 GCAAGGGGCTGTGCAACCCCGGG + Intronic
1166699232 19:44872592-44872614 TCCAGGGGCAGTGTCAACCGGGG - Intronic
1166920480 19:46226077-46226099 GCCAAGGGCAGTGAGAACCAGGG + Intergenic
1166965879 19:46529096-46529118 GCCTGGGGCCCTGTGTCCCCAGG - Intronic
1167791877 19:51688395-51688417 GCCAGAGGCTGTGAGAGCCCAGG - Intergenic
1168386066 19:55964146-55964168 GCCAGGGGCCATGTGATGCCTGG - Intronic
925003349 2:423645-423667 GCCAAGGACTGTGTGGCCCCGGG + Intergenic
925417204 2:3678716-3678738 GGAAGGGGCAGCGTGAGCCCGGG + Intronic
926840010 2:17070016-17070038 GCCAGGGGCTGTCTGGCCCTTGG - Intergenic
926885958 2:17599062-17599084 GCCAGGGGCTGTGTAGGCCCTGG + Intronic
927863319 2:26573854-26573876 GCCAGATGCTGTGAGACCCCAGG + Intronic
929234692 2:39593617-39593639 GCCCGGGGCACTGGGACTCCAGG + Intergenic
930127769 2:47816060-47816082 GCCAAGGGCGGTGAGAACCCTGG + Intronic
931177653 2:59869987-59870009 CCCTGGGGCAGTGTGGCCTCAGG + Intergenic
932307657 2:70715441-70715463 GCAAGGGACAGTGTGAGCCATGG + Intronic
933837570 2:86258244-86258266 GCCAGGGTTATTGGGACCCCTGG - Intronic
935717500 2:105952195-105952217 GTCAGGAGCAGTGGGACCCAGGG - Intergenic
935726824 2:106030877-106030899 GACAGGGACAGTGCCACCCCAGG - Intergenic
937336845 2:121067449-121067471 CCCAGGGGCAGAGAGACCCCAGG - Intergenic
937693732 2:124784761-124784783 GCCATGTCCAGTGTGACTCCAGG + Intronic
937988684 2:127650295-127650317 GGCGGGGGCAGTGTGTCTCCGGG - Intronic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
938537162 2:132256530-132256552 GCCACTGGCGGTGAGACCCCAGG - Intronic
938568911 2:132544535-132544557 GCCTGGGGCAGAGTGAGGCCTGG - Intronic
938727658 2:134121346-134121368 GCAAGGGGGTGTGTGAGCCCAGG + Intronic
940036258 2:149314970-149314992 GCCTGGGGCAGTGCAACCCCTGG - Intergenic
940162952 2:150733382-150733404 GCAAGCAGCAGTGTGGCCCCAGG + Intergenic
943180237 2:184531001-184531023 GCCAGGGACAGTGTGAGGCCTGG - Intergenic
945101093 2:206262917-206262939 GTCAGGGAGAGTATGACCCCAGG + Intergenic
947542484 2:230988510-230988532 GCCAGCCTCAGTGTGACCTCAGG - Intergenic
947871479 2:233441207-233441229 GGCAGGGGCAGGGGGAGCCCAGG + Intronic
948265302 2:236631697-236631719 GCCTGGGGCAGTGGGGCCCTGGG + Intergenic
948593108 2:239063755-239063777 GCCAAGGGCAGGGTGACCCTGGG - Intronic
948610280 2:239162328-239162350 GCCAGGGGCAGGGTGGGCCTGGG - Intronic
1171004838 20:21454362-21454384 TCCAGGGGCAGTGTGTCTTCTGG - Intergenic
1171393828 20:24818165-24818187 GCCAGGTGCAGGGTGACAGCAGG - Intergenic
1171449652 20:25226565-25226587 TCCATGGACAGTGTGAGCCCCGG + Exonic
1173755598 20:45512907-45512929 GCCAGGGGCTGTGACAGCCCTGG + Intronic
1174186018 20:48706900-48706922 GGCAGGGGCAGTGGCTCCCCTGG - Intronic
1174348842 20:49952277-49952299 GACAGGGGAAGTGGGTCCCCAGG + Exonic
1175312756 20:58023442-58023464 GCCAGGGGCAGAGTGGCGACAGG + Intergenic
1175327835 20:58142082-58142104 GCCAGGAGCAGTGGGACCCAAGG + Intergenic
1175342161 20:58239718-58239740 CCCAGGGTCAGTGCCACCCCTGG + Intergenic
1175384290 20:58584310-58584332 GCCCTGGGCTGTGTGACCTCAGG + Intergenic
1175551508 20:59820865-59820887 GCCATGGGCTGAGTGAGCCCAGG + Intronic
1176085394 20:63293447-63293469 GGCCGGGGCAGTGGGAGCCCGGG + Intronic
1177875480 21:26626313-26626335 GCCAGGGGCAGGGAGACGCCAGG + Intergenic
1178914930 21:36700863-36700885 GCCAGGGGCGCTGGGACCCGCGG + Intronic
1179106574 21:38405728-38405750 GCCAAGGCCAGCGTGTCCCCAGG - Intronic
1179469691 21:41602257-41602279 GCCACTGGCTGTGTGACCTCGGG + Intergenic
1180137263 21:45869718-45869740 GGCCTGGGGAGTGTGACCCCAGG + Intronic
1180312781 22:11253183-11253205 GCCACTGGCTGTGAGACCCCAGG - Intergenic
1180491585 22:15853974-15853996 ACCAGGGGCAGTGTGCCCAGTGG - Intergenic
1181392539 22:22594205-22594227 CCAGGGGGCACTGTGACCCCTGG + Intergenic
1181429931 22:22873085-22873107 GTCAGGGCCAGGCTGACCCCTGG - Intronic
1181597275 22:23924307-23924329 GCAAGGGGCAGTGTGGGCCTTGG - Intergenic
1183248510 22:36711749-36711771 GACAGGGCCAGTGAGACCTCAGG - Intergenic
1183469414 22:37997684-37997706 GGGAGGGGCAGGGTGACCCAGGG - Intronic
1183521952 22:38300688-38300710 GCCTGGAGCAGTGTGCACCCGGG - Intronic
1183656362 22:39187448-39187470 GCCAGGGCCAGTGTGTCACATGG - Intergenic
1184120085 22:42444483-42444505 GCCAGGGGCCGTGGGGACCCAGG - Intergenic
1184189339 22:42884608-42884630 TCCAGGGGCAGGGTGAGCCAAGG - Intronic
1184254543 22:43279686-43279708 GACAGGGGCTGTGGGAGCCCAGG - Intronic
1185039149 22:48495576-48495598 GCCAGGGGCACAGGGAGCCCAGG - Intronic
1185150115 22:49159456-49159478 CACACAGGCAGTGTGACCCCAGG - Intergenic
1185276964 22:49953987-49954009 CCCGGGGGCATTTTGACCCCAGG - Intergenic
1185320040 22:50196409-50196431 GCCCGGCGCTGTGTGGCCCCCGG + Intronic
950438590 3:12994491-12994513 ACCGGGGGCACTGCGACCCCCGG + Intronic
950458238 3:13105316-13105338 GCCAGGGGCAGAGCGAGGCCTGG + Intergenic
951700691 3:25493489-25493511 GCTCTGTGCAGTGTGACCCCAGG - Intronic
951811485 3:26705535-26705557 GCCATTACCAGTGTGACCCCAGG + Intronic
953030604 3:39177644-39177666 GCCTTGGCCGGTGTGACCCCTGG - Intergenic
954130572 3:48558675-48558697 GCCTGGGGCAGGGTGTTCCCAGG - Intronic
954387700 3:50252950-50252972 GCCAGAGGCAGGGAGACCTCTGG - Intronic
954798114 3:53171871-53171893 TCCAGGGGCAGTGAGAGCCTAGG + Intronic
954972531 3:54663358-54663380 TCCAGGGGCAGTGTGAGCCGAGG + Intronic
956837478 3:73107289-73107311 GCCACTGGCTGTGTGACCGCAGG - Intergenic
959709979 3:109376384-109376406 GGCAGGAGAAGTGTGAACCCGGG - Intergenic
961326969 3:126114700-126114722 GGTAGGGGCATTGGGACCCCAGG + Intronic
962873636 3:139519306-139519328 GCCAGAGGCTGTGGGAGCCCAGG + Intronic
963167466 3:142220228-142220250 GGCAGGAGAAGTGTGAACCCGGG - Intronic
968294845 3:197568050-197568072 ACCAGGGGCATTCAGACCCCGGG - Intronic
968361950 3:198153540-198153562 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
968729459 4:2262730-2262752 GCCGGGCGCAGAGTGGCCCCGGG + Intergenic
969318170 4:6394734-6394756 GACAGGGCCTGTGGGACCCCAGG - Intronic
969554176 4:7894914-7894936 GCCAGGGGCAGAGAGACAGCAGG - Intronic
969936764 4:10689844-10689866 GCCTTGGGCAGTTTGACTCCAGG + Intergenic
970576145 4:17430198-17430220 GCCAAGGCCTGTGTGACTCCTGG - Intergenic
974934594 4:68397559-68397581 GCTGTGGGCAGTGTGACCCATGG + Intergenic
975227448 4:71891322-71891344 GGCAGGGGTAGTGAGGCCCCCGG - Intergenic
977203178 4:94140470-94140492 CCCATGGGCAATGTGACCTCTGG + Intergenic
977696525 4:99971942-99971964 GCCAGCGGCAGTGTCAGCACAGG - Intergenic
982769630 4:159385085-159385107 ACCAGAGGCAGTGTGTTCCCTGG + Intergenic
984169447 4:176343318-176343340 GCCAGGGACAGAGTGAAGCCTGG - Intergenic
985493976 5:194151-194173 GCGGGGGGCAGTGAGACCACAGG - Intronic
985493984 5:194201-194223 GCGGGGGGCAGTGAGACCACAGG - Intronic
987323890 5:16794942-16794964 GGCAGGGACAGTGTGCACCCGGG - Intronic
989523035 5:42423610-42423632 GCCAGGCGCGGCGTGACCCCTGG + Intergenic
990701532 5:58479893-58479915 GCCAGGGTCACTGGGACCTCAGG - Intergenic
992796118 5:80256183-80256205 GCCAGCGGAAGTGCGAGCCCGGG - Intergenic
994061770 5:95486518-95486540 GGCAGGGGCAGAGTGATGCCGGG - Intronic
994246945 5:97489099-97489121 GCCAGGGACAGTCTGAAGCCTGG - Intergenic
994856403 5:105126689-105126711 GCAAGGGGCAATATGACCTCAGG - Intergenic
995365943 5:111360490-111360512 GCCAAGGGGCTTGTGACCCCTGG - Intronic
995862882 5:116660751-116660773 GCCTGGGGCAGTGTGCTCCATGG + Intergenic
997362393 5:133303438-133303460 GCCAGGGACTGTCTGTCCCCAGG + Intronic
998151550 5:139760255-139760277 ACCAGGTGCTGTGTGACCTCTGG + Intergenic
998654322 5:144159799-144159821 GGCAGGAGAAGTGTGAACCCAGG - Exonic
998808906 5:145946111-145946133 ATCTGGGGCAGTGTGACCCTGGG - Intronic
999176057 5:149632433-149632455 TCCAAGTGCATTGTGACCCCAGG - Exonic
999946056 5:156597047-156597069 GCCAGGTGCAGTCTAATCCCTGG + Intronic
1001820081 5:174703553-174703575 TCCAGGGGCACTGAGTCCCCAGG + Intergenic
1002174302 5:177392893-177392915 GCCAGGTGCAGTGTGGCTCATGG - Intronic
1003321869 6:5059004-5059026 GCCAGTAGCAGTGTCACCTCTGG - Intergenic
1003422864 6:5973954-5973976 GCCAGGGCCAGGGTGTCACCAGG - Intergenic
1004198494 6:13526964-13526986 ACCAGGGGCGGTGTGGCACCAGG + Intergenic
1004917018 6:20341548-20341570 GCCAGGGGCAGTGAGACTTTGGG + Intergenic
1006401224 6:33818708-33818730 GCCTGGGGTTGTGTGAACCCAGG + Intergenic
1006513604 6:34534297-34534319 GCCAGGGGCGATGGCACCCCGGG + Exonic
1006911774 6:37567902-37567924 GCCATGCCCAGTGTGTCCCCAGG - Intergenic
1007216920 6:40247655-40247677 GCCAAGGGCACTGTGCCCCAAGG - Intergenic
1007753961 6:44086926-44086948 GGCAGGGGTTGTGTGTCCCCTGG - Intergenic
1008646055 6:53516190-53516212 ACCTCGGGCAGTGTGAACCCAGG + Exonic
1014168554 6:118252839-118252861 TCAAGGGGAAGTGTGACCCCTGG + Intronic
1016426481 6:143941512-143941534 GCCATGGGCACTGTGAGCCTGGG - Exonic
1016958747 6:149651633-149651655 GCAAGAGGTACTGTGACCCCTGG + Intergenic
1017333704 6:153229600-153229622 GAAAGGGGCAGTGTGACCTTAGG + Intergenic
1018247858 6:161839536-161839558 TCCAGAGTCAGTGGGACCCCCGG - Intronic
1018329302 6:162710341-162710363 GCCAGGGGCTTTCTGTCCCCTGG - Intronic
1018831701 6:167448544-167448566 GCCAGTGGCACTGTGACCTCGGG + Intergenic
1018945964 6:168346690-168346712 GCCGGGGGCAGGGAGGCCCCAGG - Intergenic
1019056249 6:169225516-169225538 GTCAGGGTCAGTGTGACCTCGGG - Intronic
1019166262 6:170099534-170099556 GCCAAGGGCAGTGTGGTGCCTGG - Intergenic
1019253725 7:35167-35189 CACAGGGGCAGAGTGCCCCCAGG - Intergenic
1019487008 7:1294046-1294068 CCGAGGGGCTGTGGGACCCCGGG + Intergenic
1022510944 7:30934446-30934468 GCCAGGGGCACTGGTTCCCCAGG + Intergenic
1022812142 7:33880341-33880363 GCAAGGGTCAGTGTCTCCCCAGG - Intergenic
1024218342 7:47266829-47266851 GCCAGCTGCTATGTGACCCCTGG + Intergenic
1025068106 7:55874907-55874929 GCATGGGGCGGTGTGATCCCTGG + Intergenic
1026170013 7:67945718-67945740 GACAGAGGCAGTGTGACCACAGG - Intergenic
1026460115 7:70607095-70607117 GCCAAGTGCAGTGGGGCCCCTGG - Intronic
1027226468 7:76247053-76247075 TCCAGGGGCAGTGTGGACACAGG + Intronic
1030359442 7:108579782-108579804 GCCAGGAACAGTGTGAAGCCTGG + Intergenic
1032033147 7:128501298-128501320 GCCTGGGTCAGGGTGAACCCTGG + Intronic
1034996908 7:155583486-155583508 GACAGTGGAAGAGTGACCCCAGG + Intergenic
1035356400 7:158278254-158278276 GCCAGGGGACCTCTGACCCCAGG + Intronic
1035519517 8:266030-266052 GCCAGGGTCAGTGTCCCCCTGGG + Intergenic
1035772883 8:2163383-2163405 GCCACGGGCATCGTGACTCCAGG + Intronic
1035823878 8:2623724-2623746 GGCAGGGGCTGTGGGGCCCCGGG - Intergenic
1036294868 8:7527663-7527685 GCAAGGGGCGGTGTTAGCCCTGG - Intergenic
1036327695 8:7793328-7793350 GCAAGGGGCGGTGTTAGCCCTGG + Intergenic
1037652675 8:20853091-20853113 GCCAGGGGCTGGGTGGCACCTGG + Intergenic
1038311293 8:26448397-26448419 GCTAGGGGCAGCGTGGTCCCTGG + Intronic
1039908954 8:41809090-41809112 ACCTGGGGAAGTGTGAGCCCTGG - Intronic
1040324653 8:46335605-46335627 GGCAGGAGCAGTGAGACCTCAGG + Intergenic
1040360377 8:46659025-46659047 GTGTGGGGCAGTGTGATCCCCGG - Intergenic
1040388986 8:46933619-46933641 GCACCGGGCAGTGTGGCCCCAGG + Intergenic
1040883817 8:52237504-52237526 CTCAGGAGCTGTGTGACCCCAGG - Intronic
1044052953 8:87532504-87532526 GACTGAGGCTGTGTGACCCCAGG + Intronic
1044072394 8:87778489-87778511 GTCAGGGGCAGGGTGATCCCAGG - Intergenic
1044856173 8:96478146-96478168 GGCTGGGGCAGTTTGACCCGAGG - Intergenic
1046017218 8:108619515-108619537 GCCAGGTGCTGGGAGACCCCTGG + Intronic
1049344710 8:142132625-142132647 GCCAGCTGCAGTCTGGCCCCGGG + Intergenic
1049423276 8:142526174-142526196 GCCAGGAGGAGTGTGACCCCAGG + Intronic
1049442291 8:142614908-142614930 GTCAGGGGCAGTGAGGACCCAGG - Intergenic
1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG + Intronic
1049738623 8:144223257-144223279 GCCAGGGGCAGCGTGGGCCTAGG - Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1053281898 9:36825888-36825910 GCCAGGCTGTGTGTGACCCCAGG - Intergenic
1057188468 9:93072347-93072369 GCCAGGGGCAGGGGGACCACTGG + Intronic
1057204525 9:93163307-93163329 GCCACTGGAAGTGTGACCCCGGG - Intergenic
1057222813 9:93267010-93267032 GCCAGAGCCGGTGTGAGCCCAGG + Intronic
1058104751 9:100957121-100957143 GCCAAGGGCAGTGTGAAACAGGG - Intergenic
1060964484 9:127705117-127705139 GCCTGGGGCACTGTCACCTCTGG - Intronic
1061274424 9:129561341-129561363 GCCAGGGGCAGTGTGGAGCTAGG + Intergenic
1061876236 9:133545507-133545529 GGCAGGGGCACTCAGACCCCAGG - Intronic
1062265695 9:135685635-135685657 GCCAGGGGTAGGGTGAGCCGGGG + Intergenic
1062371671 9:136242448-136242470 GCCATGGCCTGTGTGCCCCCAGG + Intronic
1062509860 9:136898874-136898896 TCCAGGCGCAGTGTGGCCACCGG + Exonic
1062630553 9:137461315-137461337 GGCAGGGGCTGGGTGACCCGGGG + Intronic
1062746668 9:138217361-138217383 CCCAGGGGCAGAGTGCCCCCAGG + Intergenic
1188716350 X:33464002-33464024 GCCTGGGGCAGTTTGGCCACTGG - Intergenic
1190287650 X:48971616-48971638 GCAAGGTCCAGTGGGACCCCTGG + Intergenic
1193483773 X:82060358-82060380 GCCAGTGGAAGTGTTACCACAGG - Intergenic
1196194210 X:112822960-112822982 CCCAGTGGCAGTGGGAACCCGGG - Exonic
1198948216 X:142039563-142039585 GCAAGGGGAAATGTGTCCCCAGG + Intergenic
1200206673 X:154321340-154321362 GCCTGGGGCAGCGAGAACCCTGG + Intronic