ID: 1049615191

View in Genome Browser
Species Human (GRCh38)
Location 8:143572852-143572874
Sequence CACACGGACGTGCCTACAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049615191 Original CRISPR CACACGGACGTGCCTACAAT GGG Exonic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1134382062 16:13736857-13736879 CACTCAGACGTGGATACAATTGG - Intergenic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1165074548 19:33273611-33273633 CACAGGGACGTGCCCACACACGG - Intergenic
1166185529 19:41136537-41136559 TACACAGACGTACCTACAATGGG + Intergenic
1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
943374485 2:187058127-187058149 CAAATGGAAGTGCCAACAATTGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
949610011 3:5694332-5694354 TACACAGACATGCCTCCAATTGG - Intergenic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
959840344 3:110967781-110967803 TACACCGAAGTGCCTCCAATCGG - Intergenic
968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG + Intergenic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
997769318 5:136540141-136540163 CACTCAGATGTACCTACAATCGG + Intergenic
997986906 5:138508917-138508939 CACACAGACATGCCTATAAATGG - Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1059627220 9:116080256-116080278 CACACGGGTGTGCCCACCATTGG - Intergenic