ID: 1049617373

View in Genome Browser
Species Human (GRCh38)
Location 8:143581552-143581574
Sequence TGCCCCAGAGACGGAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049617363_1049617373 26 Left 1049617363 8:143581503-143581525 CCACAGTGAAATTCTCAGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 177
Right 1049617373 8:143581552-143581574 TGCCCCAGAGACGGAGGCTGTGG 0: 1
1: 1
2: 3
3: 40
4: 487
1049617367_1049617373 8 Left 1049617367 8:143581521-143581543 CCAGGCAAAGTCCAGGACAGGAG 0: 1
1: 0
2: 3
3: 17
4: 251
Right 1049617373 8:143581552-143581574 TGCCCCAGAGACGGAGGCTGTGG 0: 1
1: 1
2: 3
3: 40
4: 487
1049617370_1049617373 -3 Left 1049617370 8:143581532-143581554 CCAGGACAGGAGGCTCTTGGTGC 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1049617373 8:143581552-143581574 TGCCCCAGAGACGGAGGCTGTGG 0: 1
1: 1
2: 3
3: 40
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049617373 Original CRISPR TGCCCCAGAGACGGAGGCTG TGG Intronic
900153827 1:1195715-1195737 AGCCCAAGAGGCAGAGGCTGTGG - Intronic
900240495 1:1615284-1615306 TGCCATAGAGACGGGGGCTTGGG - Intergenic
900298545 1:1965067-1965089 GGTCACAGAGACAGAGGCTGGGG + Intronic
900591741 1:3463256-3463278 TGCCCCGGGGGCCGAGGCTGTGG - Exonic
900748075 1:4374827-4374849 TGACCAAGAGGAGGAGGCTGGGG - Intergenic
900797040 1:4714190-4714212 ATGCCCAGAGATGGAGGCTGTGG + Intronic
900824619 1:4916488-4916510 TGGCCCAGATACGGAGGCTAGGG - Intergenic
900996627 1:6126518-6126540 TCACCCAGAGGCGGAGGGTGGGG - Intronic
901331648 1:8413975-8413997 AACCCGGGAGACGGAGGCTGTGG + Intronic
901466118 1:9422267-9422289 AGCCCCAGAAATGGGGGCTGCGG + Intergenic
902285762 1:15407681-15407703 TGGGCCAGAGATGGACGCTGGGG - Intergenic
902795226 1:18796410-18796432 GGCAGCAGAGACAGAGGCTGAGG - Intergenic
902819339 1:18934175-18934197 TGCTCCAGAGGCTGAGGCAGGGG - Intronic
902861533 1:19250138-19250160 AACCCCAGAGGCGGAGGTTGTGG + Intronic
903095438 1:20968255-20968277 AACCCAGGAGACGGAGGCTGTGG - Intronic
904009380 1:27381141-27381163 AGCCCCAGAGAAGGAAGCTGGGG + Intronic
904039296 1:27575177-27575199 AGCCCCAGAGGCGGCGGCGGCGG - Intronic
904094900 1:27968976-27968998 TGACCCAGAGATGAAGGGTGGGG + Intergenic
904326763 1:29731555-29731577 TGACCCAGAGACGGTCTCTGAGG - Intergenic
904375678 1:30080786-30080808 TCCTCCAGAGAAGGAGGCCGTGG - Intergenic
904494200 1:30877600-30877622 TCCCCCAGAGGCAGAGGCGGAGG + Intronic
904681421 1:32232046-32232068 AGCCCCAGAGCCTGCGGCTGTGG - Intergenic
905017331 1:34786567-34786589 TGTACCAGAGGAGGAGGCTGGGG + Intronic
905790559 1:40787041-40787063 CTTCCCAGAGACGCAGGCTGTGG + Intronic
906319998 1:44809845-44809867 TGCCCCCAAGACTCAGGCTGGGG + Intronic
906527382 1:46502800-46502822 AGCCCCAGAGATTGAGGCTACGG + Intergenic
907055044 1:51358782-51358804 AGCCCCAGAGGCAGAGGTTGCGG - Intronic
907066748 1:51491942-51491964 AGCCCCGGAGGTGGAGGCTGCGG - Intronic
908195770 1:61744204-61744226 AGCCCAGGAGATGGAGGCTGTGG + Intronic
911400234 1:97365703-97365725 AGCCTGAGAGACGGAGGTTGCGG - Intronic
913537039 1:119782985-119783007 TGCCTCAGAGTCTGAGCCTGGGG + Intergenic
914512272 1:148344745-148344767 TCCCACAGAGACGGATCCTGGGG - Intergenic
914758767 1:150581909-150581931 AACCCAAGAGACGGAGGTTGCGG + Intergenic
915524595 1:156468028-156468050 AGCCCCAGAGCCTGAGGCTGAGG - Exonic
916240598 1:162635005-162635027 TTACCCAGAAACAGAGGCTGAGG - Intronic
916484056 1:165242232-165242254 TGCCCAATAAACGGAGGCTATGG + Intronic
916711297 1:167412061-167412083 TGCCTCGGAGGTGGAGGCTGAGG - Exonic
917986956 1:180330340-180330362 AGCCCAGGAGACTGAGGCTGTGG + Intronic
919093584 1:193002492-193002514 TGCCCGAGAGGCGGAGGTTGCGG - Intergenic
919861158 1:201740171-201740193 TGCCCCTGAGACTGCAGCTGCGG - Intronic
919902877 1:202057002-202057024 TGCCCCAGAGAGGCTGGCTCAGG - Intergenic
920312391 1:205056389-205056411 GGCCTCAGAGGCGGAGGCGGCGG - Intronic
921231772 1:213080640-213080662 AGCCCAGGAGATGGAGGCTGTGG - Intronic
922038682 1:221874667-221874689 TGCCCCAGAGGCTGTGGCTTAGG - Intergenic
922145275 1:222937949-222937971 AGCCCAAGAGACGGAGGTTGTGG - Intronic
922586529 1:226738034-226738056 AGACCCGGAGACGGTGGCTGGGG - Intronic
924002227 1:239567219-239567241 TGTCCCAGCTATGGAGGCTGAGG + Intronic
924092835 1:240520000-240520022 AACCCGAGAGACGGAGGTTGCGG + Intronic
924813857 1:247425997-247426019 GGCCTCAGAGCTGGAGGCTGGGG + Intronic
1062930114 10:1347294-1347316 TGTCCCAGGGACGCCGGCTGGGG - Intronic
1063018120 10:2098386-2098408 TGCCCAAGCGATGAAGGCTGGGG - Intergenic
1063174507 10:3539485-3539507 AGCCCCAGAGGCGGCGGCAGTGG + Intergenic
1063252416 10:4287758-4287780 TGCCCTAGAGATGGCAGCTGTGG - Intergenic
1063838458 10:10043526-10043548 AGCCCGGGAGACGGAGGTTGAGG - Intergenic
1063999402 10:11650811-11650833 AACCCCAGAGGCGGAGGTTGTGG + Intergenic
1064480613 10:15736837-15736859 AGCCCCAGAGATTGATGCTGCGG + Intergenic
1065231259 10:23601014-23601036 AACCCCAGAGAAGGAGGTTGTGG - Intergenic
1065700809 10:28423790-28423812 AGCCCCAAAGTTGGAGGCTGTGG - Intergenic
1068406802 10:56600294-56600316 AGCCCAGGAGGCGGAGGCTGTGG - Intergenic
1068775542 10:60864209-60864231 TTCCCCAGAAACAGAGCCTGAGG - Intergenic
1068794116 10:61059096-61059118 AACCCCAGAGGCGGAGGTTGTGG - Intergenic
1069883241 10:71607207-71607229 TGCCCCAGGGGCGGGGGCTTAGG + Intronic
1070777098 10:79116138-79116160 TCCCACAGAGATGGAGGGTGGGG - Intronic
1071300945 10:84255800-84255822 AACCCCAGAGGCGGAGGTTGCGG - Intronic
1071306872 10:84307244-84307266 TGGCCCAAAGACAGAGGCTAAGG + Intergenic
1072286886 10:93924859-93924881 TGACCCAGAGTTTGAGGCTGTGG - Intronic
1072797825 10:98369861-98369883 TGCCCCAGACATGGATGGTGTGG + Intergenic
1073625749 10:105095186-105095208 TGCTCCAGAGATGGAGGCTGGGG - Intronic
1073918574 10:108433156-108433178 TGCCCCACAGAAGGTGTCTGGGG - Intergenic
1074914193 10:117939814-117939836 AGCCCAGGAGATGGAGGCTGTGG + Intergenic
1075425805 10:122341031-122341053 AGCCCCTGAGAGGGAGGCAGAGG - Intergenic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1077094379 11:793121-793143 TGCTGCAGTGGCGGAGGCTGGGG - Intronic
1077094917 11:795228-795250 TGCGTGAGAGAGGGAGGCTGGGG - Intronic
1077111513 11:864163-864185 TGCCCCAGGGATGGGGGCAGGGG + Intronic
1077544767 11:3164620-3164642 TGCCCCAGAGATGGGGGCTGTGG + Intronic
1077554727 11:3220469-3220491 TGGCTCAGAGTCTGAGGCTGGGG + Intergenic
1077558052 11:3236075-3236097 TACTCAAGAGAGGGAGGCTGAGG + Intergenic
1078363834 11:10691024-10691046 AGCCCCAGAGAGAGCGGCTGAGG + Intronic
1078618435 11:12885919-12885941 CTCCCCAGGGGCGGAGGCTGTGG - Intronic
1079083998 11:17432444-17432466 AGCCCCAGAGTCGGGGGCCGGGG - Intronic
1079129600 11:17739944-17739966 AGTCCCAGAGACTGAGGCAGTGG - Intronic
1079187940 11:18254065-18254087 TGCCCCAAAGACTGTGGCAGGGG - Intergenic
1080691506 11:34562651-34562673 TGCCCCAGACACAGAGGCAGGGG + Intergenic
1080801943 11:35618156-35618178 TGGCGCAGAGCCGGAGTCTGGGG - Intergenic
1080980524 11:37399047-37399069 AGCGCCAGGGACAGAGGCTGAGG + Intergenic
1081672369 11:44949511-44949533 CGCCGGAGAGATGGAGGCTGGGG - Intronic
1081973069 11:47213399-47213421 TGCTCCGGAGACTGAGGCAGGGG + Intergenic
1083982480 11:66184233-66184255 AGCCTGAGAGGCGGAGGCTGCGG + Intronic
1083991134 11:66246428-66246450 TGCCACAGAAGGGGAGGCTGAGG - Intergenic
1084009900 11:66341609-66341631 TGTCCCAGAGATGGATGATGAGG - Exonic
1084173332 11:67410838-67410860 TGCCACATAGACGCAGCCTGTGG - Intronic
1085102567 11:73813929-73813951 TACTCCAGAGGCGGAGGCAGGGG + Intronic
1090028210 11:123185512-123185534 TGGAGCAGAGAAGGAGGCTGCGG + Intronic
1090048595 11:123358220-123358242 TCACCCAGAGAGGGAGGGTGAGG + Intergenic
1090271626 11:125389939-125389961 AGGGCCAGAGGCGGAGGCTGTGG + Intronic
1090668448 11:128930477-128930499 TGCCACTGAGAAGGAGGCCGGGG + Intergenic
1092821932 12:12360796-12360818 AGCCCGAGAGGCGGAGGTTGCGG - Intronic
1093314563 12:17632453-17632475 GAACCCAGAGACGGAGGTTGTGG - Intergenic
1095812132 12:46383077-46383099 CGCCCCAGAGGCGAAGGCGGAGG + Intergenic
1096226126 12:49867904-49867926 GGACCCAGAGTAGGAGGCTGCGG + Exonic
1096476223 12:51910860-51910882 TGCCCCAGAGGCCCAGGCTGGGG - Intronic
1096777262 12:53971953-53971975 AGCCCCAGGGACAGAGGCTGGGG + Intergenic
1096980424 12:55725527-55725549 TCCCCCAGATGAGGAGGCTGAGG + Exonic
1097092302 12:56516452-56516474 TGCTCCAGAGGCTGAGGCAGGGG + Intergenic
1097107840 12:56635669-56635691 TGCCCCAGAGACTGAAGCAAGGG - Intronic
1097707655 12:62884421-62884443 AACCCCAGAGGCAGAGGCTGTGG + Intronic
1098473715 12:70874810-70874832 TGCTCCAGAGCCTGAGGCAGGGG + Intronic
1100823878 12:98456978-98457000 CGCCCCAGAGGAGGAGGCCGAGG + Intergenic
1102075914 12:110060146-110060168 AACCCCAGAGGCGGAGGTTGCGG + Intronic
1102352050 12:112200229-112200251 AACCCGAGAGACGGAGGTTGCGG - Intronic
1102352236 12:112202281-112202303 AACCCCAGAGACAGAGGTTGCGG - Intronic
1102534403 12:113569946-113569968 TTCCGCAGAGAATGAGGCTGGGG + Intergenic
1103516544 12:121512107-121512129 TCCCCCGGAGACAGAGGCTGGGG - Intronic
1103529412 12:121590152-121590174 TACCCGAGAGGCGGAGGTTGTGG + Intergenic
1104768610 12:131346272-131346294 TGCCCCACAGCCGGAGGCATTGG - Intergenic
1104850144 12:131868786-131868808 TGCACAAGAAAGGGAGGCTGGGG - Intergenic
1105068835 12:133221500-133221522 TTCCTCAGAGAGGGAGACTGAGG - Intronic
1105546080 13:21352064-21352086 TGCCCCAGAGCAGGCTGCTGAGG - Intergenic
1106173699 13:27310193-27310215 AGCCCCGGAGATGGAGGTTGTGG - Intergenic
1106261044 13:28067098-28067120 AACCCCAGAGGCGGAGGTTGCGG - Intronic
1106689312 13:32096679-32096701 TACTCCAGAGCCTGAGGCTGAGG + Intronic
1107540768 13:41386925-41386947 TCCCCCAGCGACTGAAGCTGAGG - Intergenic
1107683554 13:42873654-42873676 TGCATCAGGGAAGGAGGCTGGGG - Intergenic
1107954716 13:45499938-45499960 AGCCCGGGAGATGGAGGCTGGGG + Intronic
1108398868 13:50018853-50018875 AACCCCAGAGGCGGAGGTTGTGG - Intronic
1108434361 13:50387202-50387224 TGCCCCAGAGACAGCAGGTGGGG - Intronic
1108938301 13:55914763-55914785 TACCCAGGAGGCGGAGGCTGTGG - Intergenic
1110778597 13:79438858-79438880 AGCCCAAGAGGCGGAGGTTGCGG - Intergenic
1114665287 14:24374026-24374048 CACCCCAGAGACAGAGTCTGTGG - Intronic
1117956294 14:61126012-61126034 TGCCCCAGAGGCATATGCTGGGG - Intergenic
1119227149 14:72953076-72953098 AGCCCCAGAGGCGGAGGTTGCGG - Intronic
1119393295 14:74306246-74306268 AGCCCAGGAGATGGAGGCTGCGG - Intronic
1119613277 14:76081766-76081788 TGCCCTTGAGATGCAGGCTGAGG + Intronic
1120835810 14:89037503-89037525 TGGGCCAGAGAGGGAAGCTGTGG + Intergenic
1121580232 14:95024593-95024615 TGGCCCAGAGGGGGATGCTGCGG - Intergenic
1121853884 14:97248640-97248662 AGCTTCAGAGACAGAGGCTGCGG + Intergenic
1122338587 14:101009646-101009668 TGGGCCAGAGAGGGAGGATGAGG - Intergenic
1122356495 14:101125965-101125987 TGCCCCAGACCCGGGTGCTGAGG - Intergenic
1122887889 14:104718629-104718651 TGCTCCAGAGAAAGAGCCTGGGG + Intronic
1122959052 14:105086187-105086209 TCCCCCAGAGAAACAGGCTGTGG - Intergenic
1125004896 15:34806607-34806629 TGCCACAGAGACTGGGGATGGGG - Intergenic
1125298339 15:38227145-38227167 TGCCCCAGAGTCAGAAGCTTGGG - Intergenic
1125463328 15:39926750-39926772 TGCTCCAGAGCCCCAGGCTGTGG + Intergenic
1125887194 15:43237918-43237940 TGCCCCAGAAATGGATCCTGAGG - Intronic
1125991726 15:44116367-44116389 TGCCCCAGAGGCTGAGGTAGGGG - Intronic
1126152262 15:45533842-45533864 AGCCCCAGAGTCTGAGGCGGTGG + Intergenic
1126522603 15:49613421-49613443 AACCCCAGAGGCGGAGGTTGCGG + Intronic
1127085618 15:55421809-55421831 AACCCCAGAGGCGGAGGTTGCGG + Intronic
1127215098 15:56815749-56815771 AACCCCAGAGGCGGAGGTTGCGG + Intronic
1127961474 15:63894013-63894035 TGGACCAGTCACGGAGGCTGAGG - Intergenic
1128601676 15:69000278-69000300 GACCACAGAGACAGAGGCTGTGG - Intronic
1128611139 15:69074469-69074491 TTCCCCAGAGACGGGAGCTTGGG + Intergenic
1129274381 15:74435377-74435399 TGCCCCAGAGAGGGAGGCTGTGG + Intergenic
1129299025 15:74615111-74615133 TGGCCCAGAGACGCAGCCGGCGG + Exonic
1129524914 15:76207657-76207679 TGCCTCACAGATAGAGGCTGGGG + Intronic
1129987106 15:79927585-79927607 AACCCCAGAGACAGAGGTTGTGG + Intergenic
1130044377 15:80432199-80432221 TGCCCCAGAGACGCAGGTGAAGG - Intronic
1130048477 15:80464272-80464294 TTCCCCAGAGGAGGAAGCTGAGG - Intronic
1130154114 15:81334785-81334807 TGCCCCAGAGCCCGAGGCCAGGG - Exonic
1131352287 15:91712357-91712379 TGCCTCAGACACGGATGCTATGG - Intergenic
1131965121 15:97834098-97834120 TTTCCCAGAGAAGGAGACTGAGG + Intergenic
1132227051 15:100150806-100150828 GGCCCCAGACACTGGGGCTGGGG - Intronic
1132292737 15:100714594-100714616 TGCCCCAGGGTCAGAGGCTGGGG + Intergenic
1132838927 16:1968835-1968857 TGCCCCACAGGAGGAGGCCGAGG + Exonic
1133120275 16:3602266-3602288 TGCCCCAGAGAGCGACGCTGCGG - Exonic
1133171662 16:3985823-3985845 TGGCCCAGAGGGGGAGGCTGTGG - Intronic
1133221772 16:4321996-4322018 AGCTCCAGAAACCGAGGCTGGGG + Intronic
1134826632 16:17289852-17289874 TGCCCCAGAGACGGGGTGTGTGG - Intronic
1135470313 16:22723656-22723678 TACTCCAGAGGCTGAGGCTGAGG + Intergenic
1136421315 16:30135312-30135334 TGCAACAGAGCTGGAGGCTGTGG + Intergenic
1136497795 16:30654684-30654706 AGCCCCAGGGACTGAGGCGGGGG - Exonic
1138895871 16:61204169-61204191 AACCCCAGAGGCGGAGGTTGTGG - Intergenic
1140258912 16:73360414-73360436 AACCCTAGAGGCGGAGGCTGTGG - Intergenic
1140477784 16:75247583-75247605 TGACCCAGAGAAGGAGTTTGGGG - Intronic
1141538220 16:84698671-84698693 AACCCCGGAGACGGAGGTTGCGG - Intergenic
1141594471 16:85088847-85088869 TGCCCCACAGCGGGAGACTGGGG - Exonic
1141624713 16:85255072-85255094 GGGCCCAGAGAGGGAGGCGGCGG + Intergenic
1141800981 16:86309078-86309100 TGCCCGGGAAATGGAGGCTGTGG + Intergenic
1141904278 16:87013299-87013321 TGCCCCACACACGCAGGCTGCGG + Intergenic
1142243664 16:88958677-88958699 TCCCCCAGGGCCGGGGGCTGGGG + Intronic
1142490509 17:275623-275645 AGCCCCAGAGGTCGAGGCTGCGG - Intronic
1142737529 17:1910755-1910777 TGCTCCGGAGGTGGAGGCTGAGG - Intergenic
1143377381 17:6474705-6474727 CGCCCCAGAGATGGAGGGTTGGG - Intronic
1144463433 17:15477569-15477591 AGGCCCAGAGTCTGAGGCTGCGG - Intronic
1145126313 17:20302810-20302832 TACTCCAGAGCCTGAGGCTGGGG + Intronic
1146666181 17:34705493-34705515 GGCCCCAGATAAGGAGTCTGAGG + Intergenic
1146780707 17:35669219-35669241 AACCCAAGAGACGGAGGTTGCGG - Intronic
1147196009 17:38767107-38767129 GGCCCCAGGGAGTGAGGCTGAGG + Exonic
1147722706 17:42548606-42548628 TCCCGCAGAGGCCGAGGCTGGGG + Intergenic
1147765490 17:42833102-42833124 CGCCCCAGTGACGTAGGCTCGGG - Intronic
1148052637 17:44776667-44776689 TGCCCCAGGGAGGAATGCTGGGG - Intronic
1148088766 17:45010077-45010099 GGTGCCAGAGACCGAGGCTGGGG + Intergenic
1148134928 17:45286107-45286129 GCCCCCAGAGACGGAAGATGAGG - Intronic
1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG + Intronic
1148223418 17:45881349-45881371 AGCCCAGGAGGCGGAGGCTGCGG + Intergenic
1148728787 17:49817548-49817570 CGCCCAAGAGGCAGAGGCTGCGG - Intronic
1148772571 17:50075827-50075849 CTCCCCAGAGACAGAGGTTGGGG + Intronic
1148786740 17:50149442-50149464 GGCCCCGGAGAAGGAGGCGGCGG - Exonic
1148979604 17:51560924-51560946 TGCCCCATGTACGGGGGCTGAGG + Intergenic
1150266000 17:63832849-63832871 GGCCGCAGACACGTAGGCTGGGG - Exonic
1150326759 17:64263622-64263644 TGCCCTTGAGACGAGGGCTGGGG + Intergenic
1150480244 17:65503715-65503737 GGGCCCAGAGACAGAGACTGGGG + Intergenic
1150793636 17:68220890-68220912 TACCCCAGAGGCTGAGGCAGGGG - Intergenic
1151066040 17:71151204-71151226 CTCCCCAGTGGCGGAGGCTGAGG - Intergenic
1151347418 17:73510575-73510597 CGCCCCAGAGGTCGAGGCTGCGG - Intronic
1151652366 17:75477929-75477951 AACCCGAGAGACGGAGGTTGTGG + Intronic
1151767953 17:76141625-76141647 TGCTCCTGGGACGGAGCCTGGGG + Intergenic
1152065501 17:78110506-78110528 TGCTCCAGAGGCTGAGGCGGAGG - Exonic
1152117175 17:78395559-78395581 CACCCCAGAGAAGGAGGCAGGGG - Intronic
1152368583 17:79871269-79871291 GGCCCGAGGGGCGGAGGCTGCGG - Intergenic
1152383729 17:79956329-79956351 AGCCCCGGAGGCTGAGGCTGCGG - Intronic
1152519509 17:80846973-80846995 TTCCCAAGAGAAGGAGGCAGTGG - Intronic
1152781312 17:82228555-82228577 GGCCTCAGAGAGGGAGGATGTGG + Intronic
1152888314 17:82865452-82865474 TAGCCCAGAGAGGGTGGCTGTGG - Intronic
1152976418 18:224499-224521 AACCCAAGAGGCGGAGGCTGCGG + Intronic
1152977598 18:237974-237996 TGCCCTAGAGGCGGAGGCATGGG - Intronic
1153549511 18:6246824-6246846 AACCCAAGAGACGGAGGTTGCGG + Intronic
1155507333 18:26547002-26547024 TTCCCCAGCGAGGGCGGCTGGGG + Intronic
1155954119 18:31942917-31942939 TGCCCCAGAAACCGAAGCGGCGG - Exonic
1156367344 18:36441200-36441222 TGCCCCAGAGCTGGATGTTGAGG + Intronic
1157087200 18:44593108-44593130 TGCACCAGAAAAGGAGGCTATGG + Intergenic
1157564883 18:48673098-48673120 TGCCACAGAGATGGGGGCAGGGG - Intronic
1158157444 18:54441954-54441976 GGCACCAGAGATGGTGGCTGGGG + Intergenic
1159754847 18:72351524-72351546 TGCACCAGAGGCAGAGGCAGAGG + Intergenic
1160503151 18:79412072-79412094 CTCCCCAGAGACGCCGGCTGTGG + Intronic
1160617802 18:80147209-80147231 AGCCCCAGAGGCGGAGGCTACGG - Intronic
1160971532 19:1769884-1769906 GACCCCAGAGGCAGAGGCTGGGG - Intronic
1161081467 19:2312635-2312657 TGTCCCAGGGAGGGAGGCTGCGG - Intronic
1161196036 19:2987273-2987295 AGCCCCTGAGACGCAGCCTGTGG - Intronic
1161348189 19:3778225-3778247 CTGCCCTGAGACGGAGGCTGGGG + Exonic
1161625496 19:5324147-5324169 TGAACCTGAGACAGAGGCTGTGG + Intronic
1161974635 19:7601394-7601416 AACCCAGGAGACGGAGGCTGTGG - Intronic
1162347311 19:10126862-10126884 TACTCCAGAGACTGAGGTTGGGG + Intergenic
1162460959 19:10813746-10813768 AGCCCAGGAGATGGAGGCTGTGG + Intronic
1162523820 19:11196583-11196605 TTTCCCAGATACGGAGACTGAGG + Intronic
1162811319 19:13165803-13165825 GAACCCAGAGACGGAGGTTGCGG - Intergenic
1163374437 19:16921735-16921757 AGCTCCAGAGATGGAGGTTGGGG - Intronic
1164579776 19:29427651-29427673 TACACCAGAGGCGGAGGCAGAGG + Intergenic
1165509455 19:36257625-36257647 CGCCCCAGAGAGTCAGGCTGCGG - Intergenic
1165767305 19:38359563-38359585 TGTCACAGAGACGGAGGAGGTGG + Exonic
1165875616 19:39004668-39004690 AGCCCAAGAGGCGGAGGTTGCGG - Intronic
1166227612 19:41406358-41406380 TACTCCAGAGAGGGAGACTGAGG - Intronic
1166369495 19:42293137-42293159 TGCCCCAGAGTCTGAGCTTGAGG + Exonic
1166504112 19:43360977-43360999 TGGGGCAAAGACGGAGGCTGGGG - Intronic
1166506345 19:43373781-43373803 TGGGGCAAAGACGGAGGCTGGGG + Intergenic
1166759027 19:45213088-45213110 CGCGCTAGAGACGGAGGCCGGGG + Exonic
1166873210 19:45883089-45883111 TGCCCCAGAGGCGGACGTTTGGG - Intergenic
1168087104 19:54056297-54056319 AACCCCAGAGGCAGAGGCTGCGG - Intronic
1168470999 19:56640729-56640751 AACCCGAGAGACGGAGGTTGCGG + Intergenic
924983025 2:240302-240324 TGCTCCAGAGCTGGAGGCTGGGG - Intronic
925610567 2:5697490-5697512 TCGCCCAGAGCGGGAGGCTGGGG - Exonic
925730975 2:6918984-6919006 TGCCCCAGTGAATGGGGCTGGGG + Intronic
926061391 2:9807232-9807254 AGCCCCAGAGGCAGACGCTGAGG - Intergenic
926089075 2:10038311-10038333 TGGCCCAGAGTCGGGGGCTGTGG - Intergenic
926115846 2:10212894-10212916 AGTCCCAGGGAGGGAGGCTGAGG + Intergenic
927369129 2:22334387-22334409 AGCCCAGGAGGCGGAGGCTGCGG - Intergenic
927561653 2:24077567-24077589 TGCCCCAGTGAAGGAGGATGGGG - Exonic
927770368 2:25855969-25855991 AACCCGGGAGACGGAGGCTGTGG - Intronic
927975012 2:27331827-27331849 TACTCCAGAGGCTGAGGCTGGGG + Intronic
927977862 2:27353514-27353536 AACCCCAGAGGCGGAGGCAGCGG - Intronic
930124536 2:47784902-47784924 TGATCCAGAGACAGAGGTTGTGG - Intronic
930640979 2:53854246-53854268 TGGCCCAGAGAAGCAGGGTGAGG + Exonic
930678473 2:54230432-54230454 AACCCAAGAGGCGGAGGCTGTGG - Intronic
930805776 2:55488517-55488539 TATCCCAGAGACTGAGGCAGGGG + Intergenic
931345499 2:61441519-61441541 AGCCCCAGAGAGGGAGACTGGGG - Intronic
931373697 2:61688566-61688588 AGCCCTGGAGGCGGAGGCTGTGG - Intergenic
932684153 2:73853642-73853664 AACCCCAGAGGCGGAGGTTGTGG + Intronic
933726368 2:85429840-85429862 GGCAGCAGAGAAGGAGGCTGGGG - Intronic
934070340 2:88378385-88378407 AACCCGAGAGGCGGAGGCTGCGG - Intergenic
937218344 2:120326977-120326999 TGACACAGAGACAGAGGGTGTGG - Intergenic
937944406 2:127319258-127319280 TACCCCTGAGAGAGAGGCTGAGG + Intronic
938387820 2:130880233-130880255 TGCCTCAGAAGTGGAGGCTGAGG + Intronic
938968402 2:136408335-136408357 TGGCCCAGGGACAGAGGCAGAGG + Intergenic
939051010 2:137307957-137307979 TGCCTCTGAGAGGGAGGCAGGGG + Intronic
940720177 2:157273718-157273740 AACCCCAGAGGCGGAGGTTGCGG - Intronic
941559044 2:167021745-167021767 AGCCCAAGAGATTGAGGCTGTGG + Intronic
941566765 2:167118370-167118392 TGCTCCAGAGGCTGAGGCAGGGG + Intronic
942246543 2:174013350-174013372 TTCCCCAGAGCTGGAAGCTGTGG + Intergenic
944654194 2:201861636-201861658 TACCCAGGAGGCGGAGGCTGCGG - Intronic
944804409 2:203267039-203267061 TGTCCCAGCTACTGAGGCTGAGG + Intronic
945774299 2:214085292-214085314 AACCCAGGAGACGGAGGCTGCGG + Intronic
946288562 2:218725295-218725317 AGCCCAGGAGATGGAGGCTGTGG - Intronic
946756609 2:222953771-222953793 TGCCCCACAGCAGGAGGCTCTGG - Intergenic
947969852 2:234313753-234313775 TGTCCCATAGACAGAGGCAGAGG - Intergenic
948257029 2:236576086-236576108 GGCCCTAGAGACGCAGGCAGTGG + Intronic
948403912 2:237703481-237703503 GGTTCCAGATACGGAGGCTGAGG + Intronic
948699074 2:239749304-239749326 GGCCCCATAGACAGAAGCTGTGG + Intergenic
948902242 2:240962691-240962713 TGTCCCAGAGGAGGAGGCGGAGG - Intronic
949057058 2:241933361-241933383 TGCCCCAGAACAGGAGGATGTGG + Intergenic
1168747061 20:252767-252789 TACTCCAGAGACTGAGGCAGGGG + Intergenic
1170123544 20:12936731-12936753 TGGCCCACAGAAGGAGGCTAAGG - Intergenic
1170733002 20:18990265-18990287 GGCCCCTGGGAGGGAGGCTGAGG - Intergenic
1170869945 20:20196197-20196219 AGCACAAGAGACGGAGCCTGTGG - Intronic
1171384817 20:24763122-24763144 TCCCCCAGACAGGGAAGCTGGGG + Intergenic
1171408191 20:24928067-24928089 GGCCCCAGACAAGGAGGATGGGG + Intergenic
1172304129 20:33869685-33869707 TGCCCCAGAAATGGTGCCTGAGG + Intergenic
1173257801 20:41407278-41407300 TCCCACAGACAAGGAGGCTGTGG - Intronic
1173282200 20:41638872-41638894 TGGCCCAGAGACAGGGGCTCTGG - Intergenic
1173345530 20:42196254-42196276 TGCCCCAGAGCCGAAAGCAGGGG + Intronic
1174363944 20:50044972-50044994 CTCCCCAGAGGAGGAGGCTGTGG + Intergenic
1174413796 20:50353644-50353666 GGCCCCAGAGAAAGAGGCTGCGG + Intergenic
1174624631 20:51903901-51903923 AGCCCAACAGGCGGAGGCTGCGG + Intergenic
1175785711 20:61710576-61710598 GGCCCCAGAGGCAGGGGCTGTGG - Intronic
1175866150 20:62178095-62178117 TGCCCCGGAGGTTGAGGCTGCGG - Intronic
1176013565 20:62914657-62914679 TGCCCCAGGGAGGCAGGCAGAGG + Intronic
1176028073 20:62996295-62996317 TGCCCCACAGGCTGAGGGTGAGG - Intergenic
1176073506 20:63238366-63238388 TGCCCCAGAGATGTAGGTTGGGG - Intronic
1176136534 20:63524803-63524825 AGCCCGGGAGGCGGAGGCTGCGG + Intergenic
1176298824 21:5088854-5088876 TGCTGCAGAAACGGAGGCAGAGG - Intergenic
1176980601 21:15376767-15376789 TGCCCCAGGGATGGAGGAGGAGG - Intergenic
1178093681 21:29191034-29191056 TGCCCAGGAGACTGAGGCTTTGG - Intergenic
1178306069 21:31491013-31491035 TACTCCAGAGGCGGAGGCTGAGG + Intronic
1178358542 21:31929334-31929356 AGCCCTAGACACAGAGGCTGTGG - Intronic
1178507419 21:33173626-33173648 TACTCCAGAGACTGAGGCAGGGG + Intergenic
1178809979 21:35872683-35872705 AGCCCAGGAGACGCAGGCTGTGG + Intronic
1178869890 21:36364572-36364594 TACTCCAGAGGCGGAGGCTGAGG + Intronic
1178916305 21:36707421-36707443 TGCCCCCGTGGTGGAGGCTGGGG + Intronic
1179481619 21:41682120-41682142 TGCCCCAGAGTCTGGTGCTGGGG - Intergenic
1179641157 21:42747850-42747872 AGCCCCAGAGAAGGGGGATGGGG + Intronic
1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG + Intergenic
1180668435 22:17533792-17533814 AACCCCAGAGGCGGAGGTTGCGG - Intronic
1181077765 22:20393029-20393051 AGCCCGAGAGACTGAGGCTACGG + Intergenic
1181266570 22:21634243-21634265 TGCCATGAAGACGGAGGCTGGGG + Exonic
1181343565 22:22201114-22201136 TGCCCCACAGAGGGAGGCCCGGG + Intergenic
1181966394 22:26658947-26658969 TGGCCCAGGGAGGGAGGCGGGGG + Intergenic
1182279261 22:29208605-29208627 AGCCCCCTAGACAGAGGCTGGGG - Intronic
1182476816 22:30581035-30581057 TGCCACAGAGGAGGAGGCCGAGG - Exonic
1182622072 22:31623810-31623832 TGGCCCTGAGGCGGAGGCTGGGG - Exonic
1183069349 22:35385547-35385569 TACTCCAGAGGCGGAGGCAGGGG - Intronic
1183412586 22:37664006-37664028 AGCCCGGGAGGCGGAGGCTGCGG - Intronic
1183484742 22:38082821-38082843 GGCCCCCCAGACGGCGGCTGGGG - Exonic
1183516280 22:38268451-38268473 TTCCACAGAGACGGAGGCCAAGG + Intronic
1183676923 22:39304353-39304375 TAACCCTGAGACAGAGGCTGGGG + Intergenic
1184520539 22:44991474-44991496 TCCCCCAGGGAAGGAGGCAGAGG + Intronic
1184549796 22:45198375-45198397 TGCCCCAGAGAGGCAGACTAGGG + Intronic
1184550564 22:45202322-45202344 TTCCCCAGGGCGGGAGGCTGAGG - Intronic
1184696572 22:46142790-46142812 AGGGCCAGAGACGCAGGCTGAGG - Intergenic
1184799209 22:46749961-46749983 TGCCCCAGAGATGAAGGGAGAGG + Intergenic
1184803464 22:46776592-46776614 TGTGCCAGAGACAGAGGCTCAGG + Intronic
1185190739 22:49434305-49434327 TGCCCTAGAGAGCGGGGCTGGGG - Intronic
1185372525 22:50467648-50467670 TGCCACAGAGAGGGAGGAAGAGG - Exonic
949177921 3:1089249-1089271 AGCCCGGGAGATGGAGGCTGTGG - Intergenic
949676027 3:6454463-6454485 TCCCCCAGAGACTGAGAGTGAGG + Intergenic
950447327 3:13045791-13045813 GGCCCCAGGGAAGGAGGCTGAGG - Intronic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
951970054 3:28433676-28433698 AACCCAGGAGACGGAGGCTGCGG + Intronic
952404988 3:32997547-32997569 TGCCCCAAAGAAGGTGGATGGGG - Intronic
952410534 3:33046164-33046186 TGCCCCACTGAGTGAGGCTGGGG - Exonic
952942955 3:38457092-38457114 TGCGCCAGAGGCTGAGGCAGGGG + Intronic
953557520 3:43958503-43958525 TTCTCCAGAGTGGGAGGCTGGGG + Intergenic
953704001 3:45217688-45217710 TGCCCTGGAGCTGGAGGCTGAGG - Intergenic
955212857 3:56958404-56958426 AGCCCAGGAGACGGAGGTTGTGG - Intronic
955227556 3:57073650-57073672 TTCTCCAGAAAAGGAGGCTGGGG - Exonic
957175199 3:76799134-76799156 AACCCAGGAGACGGAGGCTGCGG + Intronic
958143842 3:89598760-89598782 AGCCCCAGATAGGCAGGCTGTGG + Intergenic
961196307 3:125004565-125004587 AGCCCCAGAGGTTGAGGCTGTGG - Intronic
961206525 3:125086810-125086832 GGGCCCAGGGATGGAGGCTGGGG - Intronic
961411658 3:126726709-126726731 TGTCCCAGAGAGGGAGGTGGTGG + Intronic
961480249 3:127174901-127174923 AGCCCCAGAGAGGGAGGGTGAGG + Intergenic
962800199 3:138883929-138883951 AACCCGGGAGACGGAGGCTGCGG - Intergenic
963338251 3:144002248-144002270 TGCCCCTAAGAAGGAGCCTGAGG + Intronic
964747268 3:160024036-160024058 AGCCCCAGAAGCGGAGGTTGCGG + Intronic
966879071 3:184339536-184339558 AACCCCAGAGGCAGAGGCTGCGG - Intronic
966917087 3:184590973-184590995 TGGCCCAGAGAGGGAGGGTCGGG - Intronic
968182523 3:196606935-196606957 GGCCCAGGAGACAGAGGCTGCGG - Intergenic
968213457 3:196868229-196868251 TCCCCCGGAAAGGGAGGCTGTGG - Intronic
968235797 3:197029545-197029567 TGCCCCGGAGCCGCAGGCTCAGG + Intronic
968314386 3:197710520-197710542 AACCCCAGAGTCAGAGGCTGCGG + Intronic
968384526 4:124585-124607 AGCCACAGAGGCTGAGGCTGTGG - Exonic
969202587 4:5617773-5617795 AGCCCCAGAAGCGGAGCCTGAGG + Intronic
969536229 4:7757509-7757531 TGCCCCAAAGAAGGAGGCAGTGG + Intergenic
970341888 4:15115903-15115925 TACTCCAGAGCCAGAGGCTGAGG - Intergenic
970909287 4:21255533-21255555 TCACCCAGAGGCTGAGGCTGAGG - Intronic
972247138 4:37257080-37257102 TGCCCCATGGACGGACCCTGTGG + Intronic
973219574 4:47710527-47710549 TGCCACAGAGACGGACTTTGGGG + Intronic
974586672 4:63888744-63888766 GACCCCAGAGGCGGAGGTTGCGG + Intergenic
974749332 4:66116130-66116152 AGCCCAGGAGATGGAGGCTGTGG - Intergenic
976306517 4:83565574-83565596 AGCCCTAGAGGCGGAGGTTGTGG - Intronic
979608139 4:122661039-122661061 TGCCACAGATGAGGAGGCTGAGG + Intergenic
980313989 4:131172720-131172742 TCCTGCAGAGAGGGAGGCTGAGG + Intergenic
981174767 4:141668270-141668292 TGGCCCAGGGAGGTAGGCTGAGG - Intronic
982657799 4:158170940-158170962 TGCCCCAGGGCAGGAGGCTTTGG - Exonic
985109304 4:186532843-186532865 AGCCCCAGAGGCAGAGGTTGTGG - Intronic
985236343 4:187878990-187879012 TGCTCCAGAGACCTAGGCTCTGG - Intergenic
985655104 5:1127369-1127391 GGCCACAGAGATGGAGGCAGAGG + Intergenic
985659108 5:1147056-1147078 TGCCACATGGATGGAGGCTGAGG - Intergenic
986219719 5:5757079-5757101 TGCCCCAGCAAAGCAGGCTGTGG + Intergenic
986399961 5:7370906-7370928 AGCCCGGGAGATGGAGGCTGTGG + Intergenic
987141274 5:14949036-14949058 AGCCTGAGAGATGGAGGCTGCGG - Intergenic
987871796 5:23628907-23628929 AGCCCAGGAGACGGAGGTTGTGG - Intergenic
990516414 5:56534876-56534898 TTCTCCAGAGATGGAGGGTGGGG - Intronic
990953944 5:61324969-61324991 GACCCCAGAGGCGGAGGTTGTGG + Intergenic
991058506 5:62345308-62345330 AACCCCAGACACGGAGGTTGTGG + Intronic
991337404 5:65564404-65564426 AACCCCGGAGACGGAGGTTGCGG - Intronic
992591737 5:78302576-78302598 AGCCTGGGAGACGGAGGCTGCGG + Intergenic
993720420 5:91316202-91316224 AGCCCAGGAGATGGAGGCTGTGG + Intergenic
994905173 5:105832005-105832027 AACCCAGGAGACGGAGGCTGTGG - Intergenic
995829116 5:116334326-116334348 TGCCCCAGAGAAGGAACCTCTGG + Intronic
998439274 5:142142838-142142860 AACCCGAGAGACGGAGGTTGCGG + Intronic
999978052 5:156931759-156931781 TGCCACAGTGAGGAAGGCTGAGG - Intronic
1000024615 5:157347882-157347904 GGCCCCAGACTCGGAGGCGGAGG + Intronic
1000253085 5:159513646-159513668 TACCCCAGACAAGGAGGGTGGGG - Intergenic
1000484997 5:161830485-161830507 TGCCCTAGATACTGAGGATGTGG - Intergenic
1002088938 5:176793241-176793263 TGGGCCAGGGACGGAGGGTGGGG - Intergenic
1002225544 5:177720153-177720175 AACCCCAGAGAAGTAGGCTGGGG - Intronic
1002268305 5:178051052-178051074 AACCCCAGAGAAGTAGGCTGGGG + Intronic
1002279504 5:178122247-178122269 TGGCCCAGAGAAGGAGGCTGGGG + Exonic
1002279535 5:178122338-178122360 TCCTCCAGGGAAGGAGGCTGGGG + Exonic
1002480039 5:179494523-179494545 AACCCCAGAGGCAGAGGCTGCGG + Intergenic
1002523341 5:179803233-179803255 AGCCCCAGAGAGGCAGGGTGTGG - Intronic
1002888207 6:1313547-1313569 TGTCCCTGAGGCGGCGGCTGCGG - Exonic
1005930102 6:30476774-30476796 AGCCCAAGAGGCGGAGGTTGGGG + Intergenic
1006146259 6:31961580-31961602 TGCTCCTGAGATGGAGGCTCTGG - Exonic
1006294096 6:33162143-33162165 TGCCCAGGAGAGGGAGGCTAGGG + Intergenic
1006376281 6:33673346-33673368 TGCCCCAGTGATGGAGTATGAGG - Intronic
1006494399 6:34411403-34411425 AACCCCAGAGGCGGAGGTTGAGG - Intronic
1006518091 6:34555721-34555743 TGGCCCAGAGAGGCAGTCTGGGG + Intronic
1006571895 6:35012522-35012544 AGGCCCAGAGAAGAAGGCTGGGG - Intronic
1006742245 6:36317490-36317512 AGACCCAGAGATGGAGGCTGGGG - Intronic
1006853459 6:37116178-37116200 TACCCGAGAGGCGGAGGTTGTGG + Intergenic
1007840610 6:44712949-44712971 GGCCCCAGAGTCTGTGGCTGAGG + Intergenic
1008214966 6:48777776-48777798 AGGCCCAGAGACAGTGGCTGGGG + Intergenic
1008606734 6:53147504-53147526 AGCCCCAGAGGTGGAGGCTATGG - Intronic
1012915054 6:105160962-105160984 TGCCCATGAGAAGCAGGCTGGGG - Intronic
1013377014 6:109527097-109527119 AGACCCAGAGACGGAGCCAGGGG + Intronic
1013425671 6:110010446-110010468 TGCCTCAGTGAGGCAGGCTGGGG + Intergenic
1014837682 6:126178344-126178366 AGCCCCAGACACTGAGGCTGAGG + Intergenic
1015370444 6:132445324-132445346 TGCCTCAGAGAAGTAGGCTGAGG - Intergenic
1015528689 6:134198961-134198983 AGCCCAAGAGTTGGAGGCTGCGG - Intronic
1016374860 6:143409844-143409866 TACCCCAGAGGCTGAGGCAGGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017753603 6:157511041-157511063 TGGCTCTGAGGCGGAGGCTGCGG - Intronic
1017878483 6:158543397-158543419 TTCCCCAGATATGGAAGCTGGGG + Intronic
1017894388 6:158666659-158666681 TGCCCCAGGGACAAAGACTGTGG + Intronic
1018457270 6:163963392-163963414 TGCCCCAGAGTGGGACTCTGAGG + Intergenic
1019083582 6:169453483-169453505 ACTCCCAGAGATGGAGGCTGAGG - Intergenic
1019384241 7:745322-745344 TGCACCGGAGAGGGAGGCGGGGG + Intronic
1019587658 7:1813930-1813952 TGCCCCTGGGGCAGAGGCTGCGG + Intergenic
1019995091 7:4718885-4718907 AACCCCGGAGGCGGAGGCTGTGG - Intronic
1022388846 7:29926414-29926436 GGCCACAGAGGCGGAGGCGGAGG - Intronic
1023175497 7:37431957-37431979 AGGCTGAGAGACGGAGGCTGTGG - Intronic
1023983683 7:45083296-45083318 TGCCCCAGGGACAGAGCCTGTGG - Exonic
1024272810 7:47655327-47655349 GGCCCCAGGGAGGGAGGCAGCGG + Exonic
1024540041 7:50468651-50468673 TGCCACAGAGGAGGTGGCTGGGG + Intronic
1024587673 7:50855690-50855712 TGCCTCAGAGGCTGAGGATGGGG - Intergenic
1026019004 7:66693883-66693905 AGCCCCAGAGGCGGAGGTTACGG - Intronic
1027197422 7:76040217-76040239 GGCCCCAGAGACAGAGTCGGAGG - Intronic
1027337352 7:77165715-77165737 TACCACAGAGACAGATGCTGGGG - Intronic
1027686418 7:81284190-81284212 TGCCCCAGAGAGGGAGTGAGAGG + Intergenic
1028386556 7:90260408-90260430 TTCTCCAGAGGCTGAGGCTGAGG + Intronic
1028716583 7:93978145-93978167 AGCCTCAGAGGTGGAGGCTGTGG - Intronic
1029200947 7:98838884-98838906 TGGCCCAGAGACACAAGCTGTGG + Intergenic
1029268866 7:99364348-99364370 AACCCCAGAGGCGGAGGTTGTGG - Intronic
1029705205 7:102272454-102272476 GGCCGCAGAGAGGGAGACTGAGG - Intronic
1032117670 7:129130301-129130323 TTCCCCAGAGGCTGTGGCTGGGG + Intergenic
1032151449 7:129433532-129433554 AGCCCCAAAGACGTAGGCTCAGG - Intergenic
1032302009 7:130696296-130696318 AACCCAAGAGACGGAGGTTGAGG - Intergenic
1032459981 7:132103094-132103116 TGCCCTGGAGACGGAGGACGGGG + Intergenic
1033456807 7:141510605-141510627 AACCCCAGAGGCGGAGGTTGCGG + Intergenic
1034262709 7:149766604-149766626 TGGACCAGAGATGGAGACTGAGG - Intronic
1034292623 7:149945082-149945104 TTCCCCAGAAGCAGAGGCTGAGG + Intergenic
1034544998 7:151783825-151783847 AGCCCCAGAGATGGAGGTGGAGG + Intronic
1034691105 7:153014522-153014544 AACCCCAGAGGTGGAGGCTGTGG - Intergenic
1034813448 7:154151810-154151832 TTCCCCAGAAGCAGAGGCTGAGG - Intronic
1035289750 7:157830227-157830249 TGCCCCTGAGTCTGAGGATGAGG - Intronic
1035675203 8:1451290-1451312 TCCCCCAGGGACTGAGTCTGGGG - Intergenic
1035683039 8:1502855-1502877 TGCCCCAGAGAAGGCCCCTGGGG - Intronic
1036792097 8:11727723-11727745 GGCCCCAGCTAGGGAGGCTGCGG + Intronic
1037174297 8:15929125-15929147 AACCCCAGAGACGGAGGTTGCGG + Intergenic
1037522640 8:19694970-19694992 AGCCCCGGAGACAGATGCTGAGG + Intronic
1037697071 8:21232957-21232979 TCTCCCAGATGCGGAGGCTGCGG - Intergenic
1037791841 8:21951016-21951038 TACCCAAGAGGCGGAGGCTGGGG + Intronic
1037916751 8:22777649-22777671 TGCCCCAGAGCCGGGGGTGGTGG + Intronic
1038311744 8:26450181-26450203 TGCCCCAGAAAGGGGGGCCGAGG + Intronic
1038465060 8:27754572-27754594 AGCCCAGGAGGCGGAGGCTGAGG - Intronic
1038754821 8:30330680-30330702 AGCCCTGGAGACTGAGGCTGAGG + Intergenic
1039446698 8:37638852-37638874 TGCCCCAGAGAAAGAGGGAGTGG + Intergenic
1039568072 8:38565187-38565209 TGCCGCTGAGGCTGAGGCTGAGG - Intergenic
1039852062 8:41377263-41377285 GGCCCCAGGTAGGGAGGCTGAGG + Intergenic
1039973997 8:42344389-42344411 AACCCCAGAGGCGGAGGTTGTGG + Intronic
1040057661 8:43074445-43074467 AGCCCAAGAGGTGGAGGCTGTGG + Intronic
1042026872 8:64433331-64433353 GGCCCAAGATAGGGAGGCTGAGG + Intergenic
1042271984 8:66963515-66963537 AGCCCGAGAGTTGGAGGCTGAGG - Intergenic
1042355102 8:67819340-67819362 AGCCCAGGAGACTGAGGCTGTGG - Intergenic
1042590039 8:70389356-70389378 AACCCCAGAGGCGGAGGTTGCGG - Intronic
1045314921 8:101035258-101035280 GAACCCAGAGGCGGAGGCTGCGG - Intergenic
1046094386 8:109539981-109540003 TGCCCCAGAGGCTAGGGCTGGGG - Intronic
1047615097 8:126557229-126557251 GGCCCCTGAGGCGGCGGCTGCGG + Exonic
1048983694 8:139717593-139717615 TACTCCAGAGACTGAGGCAGGGG + Intergenic
1049026132 8:139990249-139990271 TGCACTGGAGACGGAGGCTCAGG + Intronic
1049391328 8:142373113-142373135 ACACCCAGAGACAGAGGCTGAGG - Intronic
1049591746 8:143465895-143465917 GGGCCCAGAGACGGTGGCTGGGG + Intronic
1049603692 8:143519519-143519541 AGCCGCAGAAACGGAGGCTCAGG + Intronic
1049617373 8:143581552-143581574 TGCCCCAGAGACGGAGGCTGTGG + Intronic
1049618733 8:143588361-143588383 GGCCCCAGAGACCGCTGCTGGGG + Intronic
1049671414 8:143871751-143871773 CCCCACAGAGACGGTGGCTGTGG + Exonic
1049689951 8:143953977-143953999 TGCCCCAGAACCACAGGCTGGGG - Intronic
1052343796 9:27388318-27388340 GCTCCCAGAGACAGAGGCTGAGG + Intronic
1052815940 9:33102647-33102669 TGCCCCAGCCAGGGAAGCTGTGG - Intergenic
1052932861 9:34069972-34069994 TAAACCAGAGACGGAGGCTGAGG - Intergenic
1053322271 9:37109768-37109790 AGCCCCAGAGGCAGAGGTTGCGG + Intergenic
1053512536 9:38700877-38700899 TGACTCAGAGAAGGAGGCTGGGG - Intergenic
1054921007 9:70542041-70542063 AGCCCAGGAGACTGAGGCTGTGG + Intronic
1057130284 9:92649946-92649968 AACCCTAGAGACGGAGGTTGTGG + Intronic
1058902971 9:109458104-109458126 TGCCCCAGCCATGGAGGCAGTGG + Intronic
1059225652 9:112670768-112670790 TGTCCCAGAGGCGGAGGATAAGG - Intergenic
1060608327 9:124938003-124938025 AGCCCCAGAGGCAGAGGTTGTGG + Intronic
1060661335 9:125406996-125407018 TGCGCCAGAGAAGGACGCTTCGG + Intergenic
1060933963 9:127505478-127505500 TGCGCCAGAGACCAGGGCTGCGG + Exonic
1061043452 9:128152377-128152399 TGCTCCAGTGACTGAAGCTGAGG - Intronic
1061416375 9:130449263-130449285 AGCCCAAGAGGTGGAGGCTGTGG + Intronic
1061485234 9:130917249-130917271 TGCCCAAGAGGCTGCGGCTGCGG - Intronic
1061645917 9:132001809-132001831 TGCTCCAGCGATGGAGGCTCTGG - Intronic
1061769198 9:132904745-132904767 GGCCCCAGAAACGGAGGCCACGG - Intronic
1061901405 9:133674045-133674067 TGCCAAAGAGAGGGAGGCTGGGG + Intronic
1062041568 9:134406768-134406790 TGTCCCAGATGCAGAGGCTGCGG - Intronic
1062283302 9:135761623-135761645 CGGACCAGGGACGGAGGCTGGGG - Intronic
1062340753 9:136093002-136093024 TGCCCCACTGACGGTGGCTGGGG + Intronic
1062520970 9:136957711-136957733 TGCCCTAGATGGGGAGGCTGAGG + Intronic
1185745935 X:2573488-2573510 TTCCCCAGACACAGAGACTGAGG + Intergenic
1185943236 X:4344775-4344797 TGCTCCAGAGGCTGAGGCAGGGG - Intergenic
1186249709 X:7652536-7652558 TGCTCCAGAGATGGTGCCTGTGG - Intergenic
1188701629 X:33271686-33271708 AACCCCAGAGGCGGAGGTTGTGG + Intronic
1189969639 X:46405130-46405152 TGTCACTGAGACAGAGGCTGGGG - Intergenic
1190008044 X:46758892-46758914 CGCCCCAGAGGAGGAGGCCGAGG + Exonic
1192738089 X:73867728-73867750 AGCCCAAGAGGTGGAGGCTGCGG + Intergenic
1194309885 X:92293341-92293363 TGGGCCAGACACGGTGGCTGAGG + Intronic
1194889749 X:99364180-99364202 TGGCCCAGAGACGGTGGCATGGG + Intergenic
1197244483 X:124154355-124154377 TACCCGAGAGGCGGAGGTTGCGG - Intronic
1198099108 X:133408652-133408674 TGAACCAGAGGCGGAGGTTGCGG + Intronic
1200072231 X:153534968-153534990 TTCCCCAGAGACGGGGGTTCAGG + Intronic