ID: 1049619954

View in Genome Browser
Species Human (GRCh38)
Location 8:143593580-143593602
Sequence GGTGCCCAGTTCCTCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 258}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049619954_1049619965 28 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619965 8:143593631-143593653 CTACGGAGGCAGCTGCCCCATGG No data
1049619954_1049619958 -9 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619958 8:143593594-143593616 CTGGGCACCCTGCAGGGGTCTGG No data
1049619954_1049619959 -6 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619959 8:143593597-143593619 GGCACCCTGCAGGGGTCTGGTGG No data
1049619954_1049619963 11 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619963 8:143593614-143593636 TGGTGGAGACGAGGATGCTACGG No data
1049619954_1049619962 2 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619962 8:143593605-143593627 GCAGGGGTCTGGTGGAGACGAGG No data
1049619954_1049619964 14 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619964 8:143593617-143593639 TGGAGACGAGGATGCTACGGAGG No data
1049619954_1049619966 29 Left 1049619954 8:143593580-143593602 CCTGCAGGGAGGAACTGGGCACC 0: 1
1: 0
2: 1
3: 36
4: 258
Right 1049619966 8:143593632-143593654 TACGGAGGCAGCTGCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049619954 Original CRISPR GGTGCCCAGTTCCTCCCTGC AGG (reversed) Intronic
900488603 1:2935329-2935351 AGCCCCCAGCTCCTCCCTGCTGG + Intergenic
901435487 1:9245021-9245043 GGTCCCCAGTTGCTCCCAGCAGG - Exonic
901701563 1:11047173-11047195 GGCGCCCACAGCCTCCCTGCAGG - Intronic
901771149 1:11531012-11531034 GGGGCCCAGTGCCTGCCTTCAGG + Exonic
901853695 1:12031178-12031200 GGGGCACAGTTCCTCCCTGATGG + Intronic
902413362 1:16225207-16225229 GATGCCCAGTTCAGCCCTCCAGG - Intergenic
902509565 1:16958792-16958814 GGTGCCCACCTGCTTCCTGCTGG - Intronic
902658836 1:17887462-17887484 GGTGGACAGTCCGTCCCTGCAGG + Intergenic
903238817 1:21968769-21968791 GGTTCCCACATCTTCCCTGCTGG + Intergenic
903242739 1:21994433-21994455 GGTTCCCACATCTTCCCTGCTGG + Intronic
903845443 1:26277310-26277332 GCAGCCCAGCTCCTCCCTGGGGG - Exonic
904584932 1:31575300-31575322 GCTGCCCATCTGCTCCCTGCAGG - Intergenic
905828915 1:41048587-41048609 GGTTCCCACTTCATACCTGCAGG - Intronic
906242805 1:44252316-44252338 GGTGCCGAGCTGCTCCCGGCTGG + Intronic
911048908 1:93652795-93652817 GGAGTCCAGTTTCACCCTGCTGG - Intronic
912512207 1:110197326-110197348 GTTTCCCAGTCCCTCCCTCCTGG - Intronic
912990280 1:114479850-114479872 GGCGCCCCCTTCCTCCCTCCCGG - Intronic
915625462 1:157111634-157111656 GGGGCCTTGTCCCTCCCTGCAGG - Intergenic
916589414 1:166176029-166176051 GGCCACCAGCTCCTCCCTGCAGG + Intergenic
916991627 1:170250982-170251004 GGTGCTAAGTCCCTCTCTGCAGG + Intergenic
917788981 1:178487397-178487419 GGAGCCCAGATCCTGCCGGCCGG - Intergenic
918074330 1:181159154-181159176 GATGCCCAGGTCCTGCCTACTGG + Intergenic
920386993 1:205576300-205576322 GGTGCTCACTGCCTCCCTGCTGG - Intronic
920572532 1:207028469-207028491 GGTGCCCTGTTCATGCCTCCAGG - Intronic
921265111 1:213415652-213415674 TGTCCCCAGTCCCTTCCTGCGGG + Intergenic
922802706 1:228371561-228371583 GGTGGCCTGCTCCTCCCTGGCGG - Exonic
923028846 1:230230591-230230613 CATGCTCAGTTCCTCCCTGAAGG - Intronic
923784201 1:237051904-237051926 GGTGCCCTGCTTCTACCTGCAGG + Intronic
1063103411 10:2971546-2971568 GGTGCCCAGGTCATTCCTGAGGG - Intergenic
1064655184 10:17549509-17549531 AGTGGCCAGTTGCTCCCAGCAGG + Intergenic
1064867277 10:19895256-19895278 GGTGCCCAGCTCTACCATGCTGG - Intronic
1065818865 10:29506884-29506906 GGCTCCCATCTCCTCCCTGCCGG - Intronic
1066217056 10:33298217-33298239 GGTGACTAGTGACTCCCTGCTGG + Intronic
1067032246 10:42885818-42885840 GGTCACCTCTTCCTCCCTGCAGG + Intergenic
1067061392 10:43079709-43079731 AGTGCCCAGCTCTTCCATGCTGG - Intronic
1067214918 10:44293560-44293582 GCTCCCCTGTTCCTCCCTCCGGG - Intronic
1067414345 10:46092207-46092229 GCCTCCCAGTTCCTCACTGCAGG - Intergenic
1067434408 10:46266753-46266775 GCTTCCCAGTTCCTCACTGCAGG - Intergenic
1067966390 10:50917868-50917890 GGTGCCCATGTCCTAGCTGCAGG + Intergenic
1069381789 10:67849406-67849428 GGAGGCCTGTTCCTCCCTGCCGG + Intergenic
1070806776 10:79275373-79275395 GGGGCCCTGTTTCTCCCTCCAGG - Intronic
1072687940 10:97549884-97549906 GGTGCCCAGGTAATCCCTTCAGG - Intronic
1072716814 10:97757695-97757717 GGTGCCCAAGTCCTCCATGGGGG + Exonic
1073306265 10:102505142-102505164 ACTGCACAATTCCTCCCTGCTGG - Intronic
1074980847 10:118619058-118619080 GGTGGCCAGTTCCAACCTGAGGG + Intergenic
1075337307 10:121617715-121617737 GGTGCCCAGATCCTCCCTCAGGG + Intergenic
1075396844 10:122133832-122133854 GGTGACCAGTTCCTCCCTCAAGG - Intronic
1077543310 11:3157810-3157832 CCTGCCCAGACCCTCCCTGCTGG - Intronic
1077544570 11:3163861-3163883 TGTGCCCAGCTGCTCCCTTCTGG - Intronic
1079110358 11:17601925-17601947 GGGGCCCAGGTGCTCCCTGTGGG + Intronic
1083167309 11:60898596-60898618 TGTGCACAGTTCCACCCTGACGG - Exonic
1083225269 11:61280969-61280991 AGTGCCTACTGCCTCCCTGCTGG - Exonic
1083430443 11:62611456-62611478 GGTGCCCCCTTCCTCCCTGCAGG - Exonic
1083778848 11:64907711-64907733 AGTGTCCAGTCCCGCCCTGCTGG + Intronic
1083839736 11:65297413-65297435 GCTGCACAAGTCCTCCCTGCTGG - Exonic
1084490895 11:69477721-69477743 TGAGCCCAGTTTCGCCCTGCAGG - Intergenic
1084563305 11:69916009-69916031 CCTGCCCTGCTCCTCCCTGCTGG - Intergenic
1084962233 11:72722904-72722926 GGTGCCCAGACCCTGCCTCCTGG - Intronic
1088543509 11:110937347-110937369 CCTGCCCATTTCCTCCCAGCTGG + Intergenic
1089292129 11:117443755-117443777 GGTGGCCAGTTCCTCACAGCTGG + Intronic
1089354474 11:117840796-117840818 GATGCCCAGGTCCTCTCTACAGG - Intronic
1089489991 11:118876906-118876928 GCAGCCCATTTCCTCCCTGCAGG + Intergenic
1091682491 12:2537066-2537088 CCTGCCCAGGGCCTCCCTGCCGG - Intronic
1091824110 12:3497135-3497157 GCTGCCCATTTTCCCCCTGCTGG - Intronic
1092064766 12:5580830-5580852 GGTGCCCAGTAGGTTCCTGCAGG + Intronic
1092172610 12:6383487-6383509 AGTGCCCAGGTCCAGCCTGCTGG + Intronic
1095088524 12:38083935-38083957 AGTGCCCACTTCCTCCTTGTAGG + Intergenic
1095670868 12:44858486-44858508 AGTGCCCAGTTCCTGACAGCTGG + Intronic
1095989985 12:48027840-48027862 GGGGCCCAGTCCCTGCCTCCAGG - Intergenic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1101813853 12:108130238-108130260 GGGGCCCACTGCCTCCCCGCTGG - Intronic
1102346978 12:112166823-112166845 GTTGCCCAGTGCCCCCCTGGAGG - Intronic
1102985244 12:117272559-117272581 TGGGCCCTGTTGCTCCCTGCAGG - Exonic
1104635928 12:130437812-130437834 CGTCCCCAGCTCCGCCCTGCAGG - Intronic
1104668975 12:130667551-130667573 GGTGGCTGTTTCCTCCCTGCTGG - Intronic
1104728501 12:131092550-131092572 GGTGGCCACTTCCTCCCAGGCGG + Intronic
1104806248 12:131591356-131591378 TGAGGACAGTTCCTCCCTGCCGG + Intergenic
1104899272 12:132179607-132179629 TGTCCCCAGCTCCTCCCTGGGGG - Intergenic
1108001693 13:45910386-45910408 GGGGCCAAGCTCCTCTCTGCTGG + Intergenic
1109071774 13:57778713-57778735 GGTGACCCTTTCCTCCCTGATGG - Intergenic
1112956103 13:105059950-105059972 GGTGCAGACTTCCTTCCTGCTGG + Intergenic
1113807865 13:113120477-113120499 GGTGCCCAGGACGGCCCTGCAGG - Exonic
1113908878 13:113832532-113832554 GATGCCCGGCCCCTCCCTGCTGG + Intronic
1113940111 13:114014610-114014632 GGCACCCAGCTCCTCCCTGAGGG + Intronic
1116282769 14:42929334-42929356 GGTGCTCAGTAGCTCCATGCAGG + Intergenic
1118308249 14:64674014-64674036 GCTGCCCAGCTCCTGCCCGCAGG - Intergenic
1121227853 14:92334501-92334523 TGTGCCCGGATCCTGCCTGCTGG + Intronic
1121717059 14:96083926-96083948 GGTGCCGAGTGCCTCCTGGCAGG + Intronic
1121717213 14:96084832-96084854 GGTGCCGAGTGCCTCCTGGCAGG + Intronic
1122366645 14:101198427-101198449 GCTGCCCAGCTCCTCCATGAGGG + Intergenic
1123015039 14:105369498-105369520 GGTGCCCAGCACCTTCCTTCTGG + Intronic
1123439073 15:20276943-20276965 CGTGCCCTGATCCTCCCTGCAGG - Intergenic
1125532345 15:40421915-40421937 GGTTCCCAGTCCCTGCCTGCCGG + Intronic
1125719014 15:41836257-41836279 GTTCCCCAGCCCCTCCCTGCAGG - Intronic
1128232741 15:66046932-66046954 GGTCCCCAGGTTCCCCCTGCAGG + Intronic
1128866814 15:71120523-71120545 GGTGCCCAGTGCCACCCTCCTGG - Intronic
1131176441 15:90212232-90212254 GCTGCCCTGTCCCTCCCTGGAGG - Intronic
1131454186 15:92570594-92570616 GGTTTCCAGTTCGTTCCTGCTGG - Intergenic
1132710611 16:1265504-1265526 GCTGCCCCGTCCCTCCCTCCTGG + Intergenic
1134022975 16:10934178-10934200 CTTGCCCAGTGCCTCCCTCCAGG + Intronic
1136016819 16:27405914-27405936 GGTGGCCAGATCCTTCCTGTGGG - Intronic
1136846097 16:33577401-33577423 CGTGCCCTGATCCTCCCTGCAGG + Intergenic
1137668072 16:50263266-50263288 TGTGCTCAGATCCTGCCTGCCGG + Intronic
1140477856 16:75247961-75247983 ACAGCACAGTTCCTCCCTGCGGG + Intronic
1141376922 16:83539863-83539885 GATGCCCAGTTTCTGACTGCTGG - Intronic
1142416831 16:89947889-89947911 TGTCCTCAGCTCCTCCCTGCGGG + Intergenic
1203107805 16_KI270728v1_random:1426055-1426077 CGTGCCCTGATCCTCCCTGCAGG + Intergenic
1142559027 17:799025-799047 CTTGCCCATTTCCTCCCTCCAGG - Intergenic
1142603228 17:1067441-1067463 GGGGCGGAGTTGCTCCCTGCGGG - Intronic
1143680152 17:8470316-8470338 TGTGTGCCGTTCCTCCCTGCTGG + Intronic
1148741812 17:49897369-49897391 GGGCCCCAGTTCCTGCCTGAGGG - Intergenic
1149321735 17:55488224-55488246 TGTGCCCACTTGGTCCCTGCAGG + Intergenic
1151162840 17:72180320-72180342 TGTGGCCAGTTCATCCATGCTGG + Intergenic
1151445234 17:74159384-74159406 AGGGCCCAGCTCCTCCCTGGTGG + Intergenic
1151555461 17:74844299-74844321 GGTGCCCAACTCATCCCAGCTGG - Exonic
1151937863 17:77274325-77274347 GTTGGACAGTTCCTCCCTGTGGG + Intergenic
1152091699 17:78250952-78250974 GGGGCCCAGTGCCCCCCAGCTGG - Intergenic
1152225977 17:79092994-79093016 GATGCCCCGTGCCACCCTGCTGG - Intronic
1153624135 18:7007221-7007243 GGTCCCCTGTCACTCCCTGCTGG + Exonic
1155441796 18:25870039-25870061 AGTGCCCAGTTTTTCCCTCCTGG + Intergenic
1155666740 18:28318112-28318134 GCTGCCCAGTTCCTCCCTTATGG + Intergenic
1156299815 18:35826648-35826670 GGTTCCCAGTTCCTCTCTCTGGG - Intergenic
1157601034 18:48893474-48893496 GATCCCCAGTACCTCCCTGAAGG + Intergenic
1157614917 18:48980724-48980746 TGTGCCCATCTCCTCCCAGCTGG + Intergenic
1160278212 18:77459588-77459610 GGTGCCAAGTTTCTCACTGTTGG - Intergenic
1160502968 18:79411330-79411352 GCTGCCCAGGTCCTCCCCGACGG - Exonic
1160875739 19:1295492-1295514 CGTGCCCCGTTCCTCGCTCCGGG + Intronic
1161118701 19:2513229-2513251 GCCGCCCAGGTCCTCCGTGCAGG - Exonic
1161202914 19:3025772-3025794 GGATCCCAGTTCCACCCTCCTGG - Intronic
1161587849 19:5115131-5115153 GCAGCCCAGCTGCTCCCTGCTGG - Intronic
1162034283 19:7931022-7931044 GGAGCCCAGGTCCTGCCTGTTGG + Intronic
1162468306 19:10856303-10856325 GGTGCCCTCTTCCTCCTTGCTGG + Exonic
1162473868 19:10888297-10888319 GGCCCCCAGTACCTCCCAGCTGG + Intronic
1162587612 19:11570317-11570339 GGAGCCCAGTTCCCCTCTGAGGG - Intronic
1162965176 19:14152135-14152157 GGTTCCCGGTAGCTCCCTGCAGG + Exonic
1163322944 19:16585307-16585329 GGTCGACAGTTCCTTCCTGCAGG + Intronic
1163383718 19:16986161-16986183 GCCCCCCAGTTCCCCCCTGCCGG + Intronic
1163523681 19:17807551-17807573 GGTGCCCTGGCCCTCCCTGCTGG - Intronic
1164752747 19:30668742-30668764 GGTGCCCAGTTCTTGGCTGGTGG + Intronic
1165035034 19:33026711-33026733 TGTGCCCTGATCCTCCCTGCAGG - Intronic
1166390377 19:42406088-42406110 GGTCCCCAGCCCGTCCCTGCAGG + Intronic
1166658602 19:44630185-44630207 TGGCCCCAGTTCCTCCCAGCTGG - Intronic
1167510420 19:49892880-49892902 TGTGGCCAGTTCCTCCCTAAAGG + Intronic
925489676 2:4377466-4377488 GGCCCCCAGTTCATTCCTGCAGG - Intergenic
926301890 2:11610880-11610902 GGTGCCCTGTTCGCCCCTGGCGG + Exonic
928209724 2:29314565-29314587 GGTGGTCAGTTCCTCAATGCTGG - Intronic
929867991 2:45734698-45734720 GATGCGCAGATCCCCCCTGCAGG + Intronic
929879320 2:45822441-45822463 GTGGCCCAGGTCCTGCCTGCAGG + Intronic
930271908 2:49267157-49267179 AGTGCCCACTTCCTGCCTGTGGG - Intergenic
931670414 2:64642276-64642298 GGGGCCCAGATTCTCCTTGCTGG + Intronic
932369133 2:71173204-71173226 AGTGCCAAGTTCCTCCCTCTTGG - Intergenic
932763070 2:74452620-74452642 TGTTGCCACTTCCTCCCTGCTGG + Intergenic
934059922 2:88284104-88284126 GGTGCCCAGCCACTCCCTGGGGG + Intergenic
934766878 2:96884660-96884682 GGTGGCCAGTGCCACACTGCTGG - Intronic
934951282 2:98577207-98577229 GGTACCCTGCTCCTGCCTGCAGG + Intronic
937323217 2:120973327-120973349 GGTGCTCAGTGCCTGCCTGCCGG - Intronic
937438332 2:121897175-121897197 GGTGCACAGATCCTGCCTCCTGG + Intergenic
938103522 2:128514103-128514125 GGGGCCCAGTCCCACTCTGCAGG - Intergenic
939860082 2:147409445-147409467 GCTGCCCATTTCCTCCTTCCAGG + Intergenic
940420690 2:153477281-153477303 GCCGCCCCGTTCCCCCCTGCTGG + Intergenic
941177379 2:162215277-162215299 GGTGCCCAGGCCCTGCCTGTTGG - Intronic
944072995 2:195694533-195694555 GGAGCCCAGTAGCTCTCTGCTGG - Intronic
946241642 2:218359566-218359588 AGAGCCCAGTGCCTCCCTGGAGG - Intronic
947744531 2:232500760-232500782 CGTGCCCAGTTTCTCCTTGTGGG - Intergenic
948689708 2:239694171-239694193 GGCCCCCACTTCCTCCCTCCCGG - Intergenic
1169118633 20:3082860-3082882 GGGGCCCACACCCTCCCTGCCGG + Intronic
1169205521 20:3738107-3738129 GGTGCACAGGCCCTGCCTGCAGG + Intronic
1170705982 20:18745326-18745348 TGTGCCTAGTTCCTCCCACCAGG + Intronic
1172174026 20:32961480-32961502 GGTGTCCAAGTCCACCCTGCAGG + Intergenic
1173410315 20:42804004-42804026 GGTGTCCATTTCCTACCTCCTGG - Intronic
1175531307 20:59675406-59675428 AGAGCCCAGATCCTTCCTGCAGG - Intronic
1175793636 20:61757759-61757781 CGTGACCAGAGCCTCCCTGCCGG - Intronic
1178619053 21:34158495-34158517 GGTGCTGAGCTCCTCCCTGATGG + Intergenic
1179635018 21:42703317-42703339 GGTGCTCACTCACTCCCTGCTGG - Intronic
1180000711 21:44994117-44994139 GGAGCCCCGTCCCTCCCTGAGGG + Intergenic
1180984300 22:19895432-19895454 GGTGCCCGTGTCCTCCTTGCCGG + Exonic
1181004204 22:20002277-20002299 GGTGCCCAGCTCTGACCTGCGGG + Intronic
1181031275 22:20149822-20149844 GGTGGCCAGTACCTCCCCGCTGG + Intronic
1181512061 22:23393577-23393599 GGTGGCCGGTACCTCCCCGCCGG - Intergenic
1181980155 22:26760419-26760441 GGTGCTCAGTTAATGCCTGCTGG + Intergenic
1182462131 22:30490566-30490588 GGGCCACAGCTCCTCCCTGCAGG - Intronic
1182487195 22:30646653-30646675 GCTGCCCAGCTTCTGCCTGCTGG + Exonic
1183322904 22:37176018-37176040 GTGCCCCAGCTCCTCCCTGCTGG + Intergenic
1183428226 22:37750942-37750964 GGTGGCCACCTCCTCCCTGCCGG + Intronic
1184259878 22:43308670-43308692 AGTGCCCAGATGCTCCGTGCAGG - Intronic
1184675680 22:46041711-46041733 GGTGCCCAGCTCCCACCTGCAGG - Intergenic
1184709018 22:46237064-46237086 GGTGCCCAGCGACTCCCTGGAGG - Exonic
1184973312 22:48043247-48043269 GGCGGCCTGGTCCTCCCTGCGGG - Intergenic
950069642 3:10141975-10141997 GGCGCCCAGTTCCTCCGGGCCGG - Exonic
950170001 3:10832294-10832316 GATCCCCAGTGCCTCCCTGGTGG - Intronic
950454714 3:13085831-13085853 GCTGCCCAGGCCCTTCCTGCGGG + Intergenic
954132517 3:48567748-48567770 GGGGACCAGCTTCTCCCTGCAGG + Exonic
954134803 3:48577012-48577034 GGTCCCCAGGTTCTCCCTGTGGG + Exonic
954401994 3:50323805-50323827 TGTGCTCACTTCCTTCCTGCTGG - Intronic
954539072 3:51381921-51381943 GGAGCCCAGGCCCTCCCTCCAGG + Exonic
954579753 3:51696858-51696880 GGGGCCCTGGTCCTCCCTACTGG - Intronic
955634135 3:61007759-61007781 GGTGTCCCATTCCTCCCTACAGG + Intronic
955637960 3:61050841-61050863 TCTGCCCAGTTTCTCCCAGCTGG - Intronic
956871057 3:73418644-73418666 GGGGCCCAGTTCCTGCTTCCAGG - Intronic
960942314 3:122943060-122943082 GGTGCCCAGGGGCCCCCTGCCGG - Intronic
961481058 3:127181040-127181062 GTCGCCCAATTCCTCCCTGCAGG - Intergenic
965257518 3:166434068-166434090 GGAGCCAAGTTTCTCACTGCTGG - Intergenic
968646696 4:1744648-1744670 GGTGCTCAGATTCTCCCTCCAGG - Intronic
968815792 4:2820992-2821014 GGTCCCCAGGTCCTGGCTGCAGG - Intronic
968892483 4:3377106-3377128 GGGACCCAGTCCCTTCCTGCTGG - Intronic
968901649 4:3434989-3435011 GGTGCCTAGCATCTCCCTGCCGG - Intronic
969522532 4:7686903-7686925 GGTGGCCAGTTACGGCCTGCAGG - Intronic
972355516 4:38276562-38276584 GGTGGGCAGCTCCTCTCTGCTGG + Intergenic
972606603 4:40619537-40619559 TGTGCCCATCTCCTCCTTGCTGG + Intronic
975591223 4:76001936-76001958 GGTGCCCAGTTAGCCTCTGCAGG - Exonic
976357682 4:84138347-84138369 GAGGCCCTGTTCCTCCCTGCAGG - Intergenic
980661865 4:135871330-135871352 GGTGTACAGTTCCTACCTGCAGG + Intergenic
980723016 4:136721314-136721336 GGGGCCAGGTTCCTCCCTGCTGG - Intergenic
984285364 4:177721892-177721914 GGTCCCCAGATCCTTTCTGCAGG + Intergenic
986579497 5:9250164-9250186 GGTTCCCAATGCCTACCTGCTGG - Intronic
987937891 5:24491629-24491651 GAAGCCCTGCTCCTCCCTGCCGG - Exonic
988460664 5:31434123-31434145 GGTGGCTAGTTTCTCCCTTCAGG - Intronic
989620531 5:43379675-43379697 GGTGTCCTGGGCCTCCCTGCTGG - Exonic
992914032 5:81429870-81429892 TGTTCTCAGATCCTCCCTGCGGG - Intronic
997667665 5:135644845-135644867 GGTGGAAAGTCCCTCCCTGCAGG - Intergenic
998757612 5:145398185-145398207 AGTGCCCAGTTGTTCCCTGAGGG - Intergenic
1004251203 6:14024539-14024561 CCTGCCCAGCTCCTGCCTGCAGG + Intergenic
1005986781 6:30880902-30880924 GCTGCTCAGTCCCTCTCTGCGGG + Intronic
1006059862 6:31411787-31411809 GGGGCCCAGTTCTTCCAGGCTGG - Intronic
1006679465 6:35786976-35786998 GGTGCCGTGTCCCTCCCTGCAGG + Exonic
1006798069 6:36743570-36743592 GGCTCCCAGTGCCTCCCTTCTGG + Intronic
1007386738 6:41525084-41525106 GGTCCCCAGTGCCTCTATGCTGG - Intergenic
1008005102 6:46402191-46402213 AGTGCCCAGTGACTCCATGCCGG - Intronic
1008138424 6:47803752-47803774 GGTGCCGAGCTCCTCTCTCCAGG - Intronic
1008385939 6:50890042-50890064 TGTGTCCTGTTTCTCCCTGCTGG + Intergenic
1009870883 6:69451253-69451275 AGTGCCTAGCTCCTCCCTGCAGG + Intergenic
1010116411 6:72316976-72316998 AGGGCCCAGTGGCTCCCTGCTGG + Intronic
1010175739 6:73026097-73026119 GGTGCCCAGTTCCTTTCAGAAGG + Intronic
1011934254 6:92754746-92754768 GGTTCCCAGTTGATCCCAGCTGG + Intergenic
1016036707 6:139390631-139390653 GGTGCACAGTTGATCCCTTCAGG - Intergenic
1016886870 6:148967276-148967298 GGAGCCCAGTGCTTTCCTGCTGG - Intronic
1017819811 6:158041175-158041197 TGTGCCCAGGGCCACCCTGCTGG + Intronic
1018813291 6:167313200-167313222 GGTCCCCAAGTCCTCCATGCTGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019737553 7:2658229-2658251 TGTGGCCAGCTCCTTCCTGCTGG + Intronic
1019978789 7:4605858-4605880 GGTGTCCAATGCCTCCCAGCTGG + Intergenic
1020010662 7:4804136-4804158 GGAGCCGACTGCCTCCCTGCAGG + Intronic
1020085758 7:5309265-5309287 TGTGCCGTGTTCCTCTCTGCCGG - Exonic
1022466670 7:30656719-30656741 GCTCCCCAGCTGCTCCCTGCTGG + Intronic
1023870935 7:44262739-44262761 GGTGCCCAGCTCCACCCGACTGG - Intronic
1024074493 7:45811646-45811668 GCGGCCCAGTTCCTCCCTCACGG + Intergenic
1024074823 7:45813004-45813026 GCAGCCCAGTTCCTCCCTCACGG + Intergenic
1024637991 7:51306215-51306237 CGTGCTCAGTTCATCCCTGCTGG + Intronic
1025130126 7:56370686-56370708 GCGGCCCAGTTCCTCCCTCACGG - Intergenic
1025131081 7:56374575-56374597 GCGGCCCAGTTCCTCCCTCACGG - Intergenic
1025208547 7:57007884-57007906 TGTGCCGTGTTCCTCTCTGCCGG + Intergenic
1025663400 7:63568994-63569016 TGTGCCGTGTTCCTCTCTGCCGG - Intergenic
1026740862 7:72977455-72977477 GAAGCCCAGGTTCTCCCTGCTGG + Intergenic
1026798164 7:73378949-73378971 GAAGCCCAGGTTCTCCCTGCTGG + Intergenic
1027102871 7:75387619-75387641 GAAGCCCAGGTTCTCCCTGCTGG - Intergenic
1029127339 7:98303662-98303684 GGAGCCCAGGACCTCCATGCTGG + Intronic
1029381685 7:100219534-100219556 GGCTCTCAGGTCCTCCCTGCTGG + Intronic
1029401850 7:100351982-100352004 GGCTCTCAGGTCCTCCCTGCTGG + Intronic
1030276045 7:107722787-107722809 GGTACCCAGTTCCTTCCTGTAGG - Intergenic
1031239374 7:119219037-119219059 GGTGCCCACATCCTCCATGATGG + Intergenic
1032799047 7:135303430-135303452 GGAGGCCAGTTCCTCCCTCTTGG - Intergenic
1032874670 7:136024778-136024800 GGAGCCCAGTTCCTTCCCTCAGG - Intergenic
1034285092 7:149879109-149879131 GGTTCCCATTTCATCCCTGGCGG - Intronic
1034434503 7:151056951-151056973 TGTGCCGAGTTCCGCCCTCCGGG - Exonic
1034859938 7:154586331-154586353 GATGGCCATTTCCTACCTGCCGG + Intronic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1039835776 8:41255266-41255288 GGGTCCCTGTTCCTGCCTGCTGG + Intergenic
1039966327 8:42286869-42286891 GGTGCCCTGTGCCACCCTGCAGG + Intronic
1042639697 8:70919802-70919824 GGTGCCCCTTTCCTGCGTGCTGG - Intergenic
1043734986 8:83730817-83730839 GGTGGGCAGTTCTTCCCTGTTGG + Intergenic
1044249454 8:89988965-89988987 CAGGCCCAGTTCTTCCCTGCTGG + Intronic
1044864283 8:96554893-96554915 TGGGCCCAGCTCCTCCCTCCAGG + Intronic
1048512966 8:135078998-135079020 AGTCTCCAGTTCCACCCTGCAGG + Intergenic
1049034783 8:140066668-140066690 GGTGTTAAGTACCTCCCTGCTGG - Intronic
1049321579 8:141999646-141999668 AGTGCCCAGACCCTCCCAGCTGG + Intergenic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1049674493 8:143883659-143883681 TGGGCCCAGTTCCTACCTGCAGG + Intergenic
1053020633 9:34691600-34691622 GGAGCACAGTTCCTCACTGTGGG - Intergenic
1054918102 9:70514398-70514420 GGTGGCCTGTTCCTTCCTGGAGG + Intergenic
1057492744 9:95534518-95534540 GTTGCCCAGAGTCTCCCTGCAGG + Intergenic
1058583523 9:106483553-106483575 GATGCCCTGTTCATCCCAGCTGG + Intergenic
1060061593 9:120465460-120465482 GGTGCTCAGTTCCTGCCTGTTGG - Intronic
1061070224 9:128305305-128305327 GGTGCCCAGTTCATACAGGCAGG + Intergenic
1062344905 9:136110091-136110113 TCTGCCCAGGCCCTCCCTGCAGG - Intergenic
1062428252 9:136515941-136515963 CGTCCCCAGTCCCTCCCCGCTGG + Intronic
1062521151 9:136958554-136958576 GGTGCCCTCCTCCTCCCTGGCGG + Intergenic
1062731666 9:138113517-138113539 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731695 9:138113649-138113671 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731715 9:138113737-138113759 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731768 9:138113957-138113979 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1062731778 9:138114001-138114023 GGTGCCCAACTCCTCCTTGTGGG + Intronic
1185558792 X:1042742-1042764 GGTGACGAGTTCCTCACTGAAGG + Intergenic
1185674003 X:1833816-1833838 GGTTCCCAGCACCTCCCTGAGGG - Intergenic
1192081674 X:68053719-68053741 GGCCCCCAGATCCTCCCTGCCGG - Exonic
1201771945 Y:17623988-17624010 AGTGCCCACTTCCTCCTTGTAGG - Intergenic
1201829610 Y:18281998-18282020 AGTGCCCACTTCCTCCTTGTAGG + Intergenic