ID: 1049629213

View in Genome Browser
Species Human (GRCh38)
Location 8:143643244-143643266
Sequence CTGGAGGCCCTGGGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049629213_1049629221 30 Left 1049629213 8:143643244-143643266 CCAGTTTTCCCCAGGGCCTCCAG 0: 1
1: 0
2: 3
3: 40
4: 330
Right 1049629221 8:143643297-143643319 CAGCTTTGCGTGACCCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049629213 Original CRISPR CTGGAGGCCCTGGGGAAAAC TGG (reversed) Intronic
900120235 1:1045717-1045739 CTGCAGGCTTTGGGGAAAATCGG - Exonic
900197013 1:1381557-1381579 CTGGAGGCTCTGGGGACAATGGG + Intergenic
900529947 1:3148255-3148277 CTGGTGGCCCTGGTGAGAGCAGG + Intronic
900977268 1:6025571-6025593 CAGGTGGCCCTGGGGAGGACGGG - Intronic
901055380 1:6446668-6446690 CAGGGTGCCCTGGGGAACACTGG + Intronic
901425576 1:9180755-9180777 CTGGAGGCCCAAGAGAAAGCTGG + Intergenic
902466503 1:16621817-16621839 GTGGAGGCCCTGGGGACAGCTGG - Intergenic
902478990 1:16701921-16701943 CAGGGTGCCCTGGGGAACACTGG - Intergenic
902798630 1:18815740-18815762 CTTGAAGCCTTGGGGAAACCAGG + Intergenic
903533684 1:24052251-24052273 CTGGAGGCCCAGGTGAAAAGAGG + Intergenic
903829270 1:26164869-26164891 AGGGAAGCCCTGGGGAAAAGAGG + Intergenic
904287336 1:29461019-29461041 ATGGTGGCCTTGGGGAAAAGGGG + Intergenic
904450226 1:30606260-30606282 CTGGAGACACTGGGTAAAAGGGG - Intergenic
905466789 1:38160647-38160669 CTGCAGGCCATGGGGAATTCAGG - Intergenic
906535774 1:46550317-46550339 CTGGGGGCCCTGGGGAAGCGTGG - Intronic
906895217 1:49763703-49763725 CTGGAGGCCCTGGGGGAGTCAGG - Intronic
906949571 1:50323423-50323445 CTAGAGGCCCTGGGGGAATCTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907542216 1:55226194-55226216 CTGGGGGCGTTGGGGGAAACAGG - Intergenic
907859272 1:58335587-58335609 CTGGAGGCCAGGGTGGAAACGGG + Intronic
909500670 1:76331663-76331685 CTGGAGGTGGTGAGGAAAACAGG - Intronic
910862018 1:91751033-91751055 GTGGAGGATCTAGGGAAAACTGG - Intronic
912280493 1:108308083-108308105 CTACAGGCCATGGGGAATACTGG + Intergenic
912287733 1:108386274-108386296 CTACAGGCCATGGGGAATACTGG - Intronic
914460412 1:147878359-147878381 CTGGAGGCTCTGGGGAAGTCTGG - Intergenic
923162174 1:231323979-231324001 CTGGAGGGGGTGGGGGAAACAGG + Intergenic
923363342 1:233234837-233234859 GTGGGGGCCCTGTGGAATACGGG - Intronic
923655492 1:235912349-235912371 GTGTAGGGCCTGGGGAAATCAGG + Intergenic
923671212 1:236042900-236042922 CTGGAGGCAGTGGGGAAAGCTGG - Intronic
923919809 1:238550529-238550551 TTGGATACCCTGGGGAAATCAGG + Intergenic
1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1066602865 10:37126085-37126107 CTGGGGGGCCTGGGGAAGAAGGG + Intronic
1068732647 10:60376162-60376184 TTGGAGGCCCTGTGGAATAAGGG - Intronic
1070238690 10:74656255-74656277 CTGTGGGCCCTGGGGGAAACTGG - Intronic
1070432779 10:76357932-76357954 TTGGAGGCCATTGTGAAAACAGG + Intronic
1070669018 10:78365078-78365100 GTGGAGCACCTGGAGAAAACAGG - Intergenic
1071344566 10:84680282-84680304 CTGGAGGCCAAGGGAGAAACTGG + Intergenic
1071518813 10:86316398-86316420 CTGGAGACTCTGGAGAACACTGG - Intronic
1072263297 10:93702748-93702770 AAGGAGGCCCAGGGAAAAACTGG - Intergenic
1072785836 10:98281387-98281409 CTGGAAGCAGAGGGGAAAACAGG - Intergenic
1074813901 10:117130646-117130668 CTGGAGGCCCTTGGGGAAGGAGG + Intronic
1076358622 10:129870658-129870680 CCGCAGGCCCTGGGGAGAGCCGG - Intronic
1076387173 10:130065568-130065590 CTGGATGCCATGGTGAATACAGG + Intergenic
1076617325 10:131764310-131764332 CTGGGGGCACTGGGGAGAGCAGG - Intergenic
1076875873 10:133215249-133215271 CTGAAGGCTCTGGGGGAACCAGG + Intronic
1077132118 11:978249-978271 CAGAAGGCCCAGGGGAAAGCAGG - Intronic
1077440625 11:2567065-2567087 CGGGAGGCTCTGGGGGAGACTGG + Intronic
1077462545 11:2717864-2717886 CTGGAGGCCCTGGGGCGAGTGGG - Intronic
1077504279 11:2922875-2922897 CTGGAGGCCCCGGGGACTTCTGG + Intronic
1078403254 11:11045907-11045929 CAGGAGGGGCTGGAGAAAACAGG + Intergenic
1080190995 11:29549216-29549238 CTGGAGGCAATGGGGAAATCAGG - Intergenic
1081644278 11:44778898-44778920 CTGGAGGTCCTGGGGATCTCTGG + Intronic
1081783158 11:45727490-45727512 CTGGTGGCCCTGAAGAAAAGGGG + Intergenic
1083323882 11:61863614-61863636 CTGGAGACCCTGGGTAAGGCTGG + Intronic
1083758048 11:64801929-64801951 CTGTAGGTCCTGGGGAAAAGGGG - Intronic
1084005747 11:66322720-66322742 CTGGAGGCCATGGGGAAGAGAGG + Intergenic
1085026128 11:73237684-73237706 CTGGAGACCCTGGGTGAACCAGG + Intergenic
1086420160 11:86630886-86630908 CAGGAGCCCCTGAGGAAACCTGG + Intronic
1087047422 11:93853782-93853804 ATGAAAGCCCTTGGGAAAACTGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088590671 11:111399985-111400007 TGGGAGGCCCTGGAGAAAGCCGG + Intronic
1089009710 11:115122508-115122530 CTGCAGGACCTGGGGAGAATGGG - Intergenic
1089531504 11:119132818-119132840 TTGGAGGACATGGGGAACACTGG - Intronic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1091363027 11:134993268-134993290 CTGGAGGCTTTGGGGAGCACCGG - Intergenic
1092236899 12:6816052-6816074 CTGGAGGCCTTCTGGAAAGCTGG - Exonic
1092317046 12:7428071-7428093 CTGGTTGCCCTTGGCAAAACTGG + Intronic
1094110649 12:26858767-26858789 CTGGAGGCTCTGGGGAGAACTGG - Intergenic
1095308154 12:40662483-40662505 CCAGAGGCCTTGGGGAAAAATGG + Intergenic
1096551019 12:52371698-52371720 TTGGAGGGCCAGGGGCAAACAGG - Intergenic
1097247180 12:57613027-57613049 CTGGGGGGCCTGGGGAACAGGGG - Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098239887 12:68456218-68456240 CAGGAGCCCGTGGGGAAGACTGG - Intergenic
1099681978 12:85841364-85841386 ATGAAGGCCCTGGGGACAACTGG - Intergenic
1100331033 12:93582405-93582427 CTGGAGGTCCTTTGGAAAAATGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1103360008 12:120347865-120347887 CAGGATGCCCTTGGCAAAACAGG + Intronic
1103483645 12:121267870-121267892 CTGGGGGCTCTGGGGAACAGGGG - Intronic
1103920127 12:124395043-124395065 CCGAAGGCCCTGGGGAAACCTGG + Intronic
1106054049 13:26221941-26221963 CTGGAGACGCCGGGGAAAGCAGG - Intronic
1106460673 13:29964897-29964919 CTGGAACCCTTGGGGAAAGCAGG - Intergenic
1106813851 13:33386347-33386369 CTGGAGCCCCTGAGGAAGGCAGG - Intergenic
1107596657 13:41970175-41970197 GTGGTAGGCCTGGGGAAAACAGG + Intergenic
1110469299 13:75840904-75840926 CTGCAGGCACTGGGGTAAAAAGG - Intronic
1114396605 14:22368837-22368859 CTGGAGACTCAGGGGAGAACGGG + Intergenic
1115321180 14:32080673-32080695 CCAGAGGTCCTGAGGAAAACAGG - Intronic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119260817 14:73237350-73237372 GTGGAGGCCCCGGGCAACACCGG + Intergenic
1119668894 14:76504001-76504023 GGGGAGGCCCTGGGGAACAAGGG + Intergenic
1119716147 14:76860869-76860891 CAGGGAGCCCTGGGGAAAGCTGG + Intronic
1119777807 14:77259245-77259267 CTGGAGGCTCTAGGCAATACCGG - Exonic
1120402822 14:84054175-84054197 CTGAAGGCCATGGAGAAAAAAGG + Intergenic
1121240622 14:92427480-92427502 CTGGCTGCCCTGTGGAAAACAGG + Intronic
1121618507 14:95330227-95330249 CTGGAGGCCTACGGGAAAATGGG - Intergenic
1122540714 14:102496331-102496353 TGGGAAGCCCTGGGGCAAACTGG + Intronic
1122922488 14:104885730-104885752 TTTGAGGTCCTGGGCAAAACGGG + Intronic
1123106829 14:105845708-105845730 CTGGAGGCTCTGAGGACAAGGGG + Intergenic
1123187140 14:106530826-106530848 CTGGGGGCACTGAGGAAACCAGG - Intergenic
1123189912 14:106559235-106559257 AGGGAGCACCTGGGGAAAACAGG + Intergenic
1123190414 14:106564241-106564263 CGGGAGGCCCTCGGGACACCAGG - Intergenic
1123406254 15:20020907-20020929 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123412842 15:20073818-20073840 CTCCAGGCCCTGGGGACACCTGG + Intergenic
1123515584 15:21027555-21027577 CTGGAGGCTCTGAGGGAGACGGG + Intergenic
1123522184 15:21080931-21080953 CTCCAGGCCCTGGGGACACCTGG + Intergenic
1125361890 15:38873195-38873217 CTGGAGGCAGTGGGGAAGAAGGG - Intergenic
1125757032 15:42071169-42071191 CTGGAGGCCCTGGAGGAAGTTGG + Exonic
1127488738 15:59442131-59442153 CTGGGGGCCCTGGGTAAACAGGG - Intronic
1128267507 15:66279601-66279623 CTGTAGGCACTGGGGAACCCTGG - Intergenic
1128345739 15:66851368-66851390 CTGGCGGCCGTGTGGAGAACAGG + Intergenic
1128486416 15:68094959-68094981 CTGGATGCCTTGGGGAATTCTGG - Intronic
1128619073 15:69133632-69133654 CTGAAGGCCCTGGGGCAAGTTGG - Intergenic
1128791844 15:70439903-70439925 CTGGGGAGCCTGGGGAACACTGG - Intergenic
1128901919 15:71430846-71430868 ATAGAAGCCCTGGGAAAAACTGG - Intronic
1131368099 15:91856263-91856285 CTGGAGGCCCAGGAGAGGACAGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1132201048 15:99955027-99955049 CTGGAGGCGGGGGGCAAAACTGG + Intergenic
1132694961 16:1197989-1198011 CTGGAGGCGGTGGGGAGGACCGG - Intronic
1135607593 16:23836932-23836954 CTGGAGGGACTGGGGAAGAAAGG - Intronic
1136511768 16:30742367-30742389 CTGGAGGCCCTTGGGAATCTGGG - Intronic
1136619021 16:31415691-31415713 CTGGAGCTTCGGGGGAAAACGGG - Intronic
1137275694 16:46931946-46931968 CTGGAGGCCCGTGGGCAAAGGGG + Intergenic
1138402987 16:56763684-56763706 TTGGAGGCTGTGGGGAAAACAGG - Intronic
1139062058 16:63264127-63264149 CTGGAGGCCCTGGTGGAAGGGGG + Intergenic
1140167235 16:72565121-72565143 CTGTAAGCCATGGTGAAAACTGG + Intergenic
1140466783 16:75189268-75189290 CTGGAGGCCAAGGAGTAAACAGG + Intergenic
1140597039 16:76428688-76428710 CTGTAGGCCCTGGAGGAATCAGG - Intronic
1141441131 16:84030337-84030359 GAGGAGGCCCTGGTAAAAACAGG - Intronic
1141689894 16:85590865-85590887 CGGCTAGCCCTGGGGAAAACGGG - Intergenic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1141868953 16:86771364-86771386 CTGGAGTCCCTGTGGGACACAGG + Intergenic
1141870746 16:86783893-86783915 CTGAATGCCCTGTGGAAAGCGGG + Intergenic
1142223483 16:88866318-88866340 GTGGAGGCCCTGGGGATCTCAGG - Intronic
1142413223 16:89926470-89926492 CTTGGGGTCCTGGGGAAAGCGGG - Intronic
1142711712 17:1727150-1727172 CTGGAGGAGCTGGAGAAAACGGG + Exonic
1143164465 17:4891040-4891062 CTGGGGGCCCTGGGGAGGCCTGG - Exonic
1143198320 17:5094141-5094163 CTGGAGGCCCTGGCTAAGTCAGG + Exonic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1145304507 17:21666016-21666038 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1145791992 17:27633019-27633041 TTGGAGGGCCTGGGGGAAGCTGG + Intronic
1146646009 17:34578173-34578195 TTGGAGGCCCTGGGGATAGAAGG - Intronic
1146846468 17:36184212-36184234 CTGGAGGGCCTGGGGGAGGCTGG + Intronic
1147187257 17:38719665-38719687 CTGGAACCCCTGGGGGATACGGG + Intronic
1148136223 17:45293608-45293630 GTGAAGGACATGGGGAAAACAGG + Intronic
1148243196 17:46013250-46013272 CTGGAGGCCCTGGGGACTCCAGG + Intronic
1148581574 17:48747505-48747527 CTGGAGGCCCAGGAGAAACACGG - Intergenic
1149849815 17:60027605-60027627 CTGGAGGGCCTGGGGGAGGCTGG + Intergenic
1149860353 17:60118919-60118941 CTGGAGGGCCTGGGGGAGGCTGG - Intergenic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1152129696 17:78468586-78468608 CTTGAGGCCCTGCCGAAGACGGG + Intronic
1152276180 17:79358924-79358946 CTGGGGGCACTTGGGAAAAGAGG - Intronic
1152539200 17:80966475-80966497 CTGGTGGCCCTGGGGACAGCAGG - Intergenic
1152868624 17:82738522-82738544 CTGGAGGCCCTCAGGAGCACGGG + Exonic
1153594935 18:6715756-6715778 CTGGGGGCCCTGGGAAATTCTGG + Intergenic
1153997721 18:10455725-10455747 CTAGAACCCCTGGGGAAAAGTGG - Intronic
1155191085 18:23431211-23431233 CTGGTAGCCCTGGGAAAAAGTGG - Intronic
1155361347 18:25006273-25006295 CTAGAGGCCCTGTGCAAAGCAGG - Intergenic
1158110313 18:53933394-53933416 CTGGAGACCCTGAGTAATACAGG - Intergenic
1158505731 18:58044577-58044599 CTGGAGGCAGAGGGGAGAACCGG + Exonic
1159654972 18:71022481-71022503 CTGGAGGCCCTGGGAAAGAAAGG + Intergenic
1160546083 18:79657003-79657025 CTGGAAACCCTGGAGAAAAGTGG + Intergenic
1160745631 19:709639-709661 CTGGAGGCCCTTGGGAAGGGCGG - Intronic
1161267139 19:3369587-3369609 CTGGCGGCCCTGGGGCATTCTGG + Intronic
1161456820 19:4373773-4373795 CTGGGGGCCGTGGGGAAGCCGGG - Intronic
1161742046 19:6027358-6027380 CTGGAGGACCAGGGGAAAGTAGG + Intronic
1161778553 19:6277177-6277199 CCGGAGGCCCCTGGGGAAACAGG - Intronic
1161850531 19:6735881-6735903 GTGGAGGGCATGGGGAAGACGGG - Intronic
1162342986 19:10102920-10102942 CTGCAGGCCCTGGGGCAGCCAGG + Intergenic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1163711929 19:18852153-18852175 CTGGAGGACCTGGAGAAGCCGGG + Exonic
1165309055 19:35019566-35019588 CAGGAGGCCCTGGGGCCACCAGG - Intronic
1165425933 19:35745388-35745410 CTGGAGGGCTTGGGTAAAAATGG - Exonic
1165471446 19:36006936-36006958 CTGGAGGGCCTGGGGACATATGG + Exonic
1166357169 19:42234020-42234042 CTGGAGACCTTGGGGGAACCGGG - Intronic
1166691270 19:44822453-44822475 GAGGAGTCCCTGGGGAAAGCGGG + Intergenic
1167300842 19:48676548-48676570 CTGGGAGCCCTGGGGAGAGCTGG + Intergenic
1167357217 19:49011323-49011345 CAGGGGCCTCTGGGGAAAACAGG + Intronic
1167574710 19:50312486-50312508 CTGGCGGCCGGGGGGAAAAGGGG + Intronic
1167709410 19:51100689-51100711 CTGGAGGCTCTGGGGCAAGGGGG - Intronic
1168332344 19:55578045-55578067 CAGGAGGCGCTGAGGAAGACAGG + Exonic
1168405167 19:56106894-56106916 CTGGAGGGACTCGGGAAAATCGG - Intronic
1168455540 19:56505146-56505168 ATGGAGCCTGTGGGGAAAACTGG + Intergenic
1202713031 1_KI270714v1_random:27828-27850 CAGGGTGCCCTGGGGAACACTGG - Intergenic
925048833 2:795682-795704 CTGGGGGCCCTGGGGGGAGCTGG + Intergenic
927010154 2:18895785-18895807 CTGGTGGCCCTGGGGAAAGGAGG - Intergenic
927200353 2:20574553-20574575 CTGGAGGGCCAGGGGATCACTGG + Intronic
929361624 2:41098821-41098843 CTGAAGGCCCGAGGGAGAACTGG + Intergenic
929667491 2:43844493-43844515 CTGGAGGCCCTGTGGGAGACAGG - Exonic
930097381 2:47575751-47575773 TGGAAGGCCCTGGGTAAAACTGG - Intergenic
930762617 2:55051581-55051603 CTGGAGGCCCTGGAGAGAAGAGG + Intronic
932467503 2:71933132-71933154 CAGGAGGCCCTGGGGCACAGTGG - Intergenic
932621176 2:73265632-73265654 CTGGAGGCCCTGGGGCAGGGTGG + Exonic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933009063 2:77034539-77034561 GTGGAAGCTCTGGGGAAATCTGG + Intronic
933584127 2:84161472-84161494 CAGGAGGAGCTGGGGAAAACTGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
933752078 2:85609341-85609363 TTGGGGGTCCTGAGGAAAACAGG + Intronic
934750830 2:96793148-96793170 CTGGAAGCCCTGGGCAGAAAGGG + Intronic
935516804 2:104050374-104050396 CTGAAGGGCCTGGGGAGAAGTGG - Intergenic
936028749 2:109054296-109054318 CAGGATGCCCTGGGGAGAGCAGG - Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
941185539 2:162318048-162318070 GTGGAGGCCCTCCGGAGAACCGG - Exonic
942149264 2:173058376-173058398 CTGGAGGCCCAGGTCAGAACTGG + Intergenic
942241390 2:173965754-173965776 CGCGAGGCCCTGGGGAGATCCGG - Intergenic
942543542 2:177039141-177039163 CTGGAAGCCCTGGAGGGAACAGG - Intergenic
942623089 2:177869318-177869340 CTGAAGGCTCTGGGGAAGAATGG + Intronic
944124105 2:196274071-196274093 CTGGATGGCCTGGGAAGAACTGG + Exonic
944594334 2:201247430-201247452 CTGCAGCCCCTGGGGAAATGTGG - Intronic
944938208 2:204592090-204592112 CCGGAGGGCAAGGGGAAAACTGG + Intronic
946042935 2:216798092-216798114 CTGGAGGCTCTGGGATCAACAGG - Intergenic
946419754 2:219558102-219558124 CTGGAGGCTCTGGAGAAGAGAGG + Exonic
948353146 2:237357344-237357366 CTGGAGGACCTGGAGAAACTGGG - Exonic
948636487 2:239341107-239341129 GAGGAGGCCCTAGGGGAAACTGG - Intronic
1173865446 20:46309542-46309564 CTGGAAGCCATGGGGAATAGGGG - Intergenic
1173972222 20:47161672-47161694 CTGGAGGCCCTGGGGACCCTGGG - Intronic
1174293512 20:49526432-49526454 CTGTAGGCACAGGGGAAAAGTGG - Intronic
1174588248 20:51625199-51625221 CTGGAGACCCTGAGGAATGCTGG - Exonic
1175326450 20:58132067-58132089 GGTGAGGCCCTGGGGAACACAGG - Intergenic
1175567672 20:59993808-59993830 GTGTTGCCCCTGGGGAAAACTGG - Intronic
1175847855 20:62067993-62068015 CAGAAGGCCCTGGGGAAAGTGGG + Intergenic
1176091528 20:63320553-63320575 CTGGAGGCCCTGGGGCAGGCTGG + Intronic
1176179416 20:63742439-63742461 ATGGAGGCCGTGGGGGACACTGG - Exonic
1176655827 21:9588443-9588465 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1179610535 21:42547432-42547454 CTGAGGCCCCTGGGGAAACCAGG - Intronic
1179717502 21:43297454-43297476 CTGGAGCTCCTGGGGGCAACAGG - Intergenic
1180157032 21:45982821-45982843 GTGGGGGCCCAGGGGAACACGGG + Intronic
1180635257 22:17258607-17258629 CTGGAGTCCCCAAGGAAAACGGG + Intergenic
1180961483 22:19764350-19764372 CTCGAGGCCTTGGGGGACACCGG - Intronic
1181458828 22:23074321-23074343 CTGGAGGCCCTGAGAAATGCAGG + Intronic
1181507887 22:23373870-23373892 CTGGAGGAGCTGGGGAAACCGGG + Intergenic
1181536588 22:23549422-23549444 CTGGAGGCCAGGGGAAAACCAGG - Intergenic
1182666681 22:31965214-31965236 CTGGCGGCCCAGCGGAAAGCAGG - Intergenic
1182736724 22:32536127-32536149 CAGGAGGCACTGGGGAAGGCTGG + Intronic
1184720423 22:46309410-46309432 CTGGAGGTCTGGGGGAAAGCTGG + Intronic
1184885864 22:47344107-47344129 CTGGAGGGCATGGGGAAAGCAGG + Intergenic
1185023556 22:48394858-48394880 CTGGTGGCCCTGCGGAACTCTGG - Intergenic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950628711 3:14267238-14267260 CTGGAGGCCCTGGGCAGCCCTGG - Intergenic
953158675 3:40398167-40398189 CTGCAGACCCTGGTGAAAGCTGG + Intronic
954134798 3:48576998-48577020 CTGGGGACCCTGGAGAAGACGGG - Exonic
954685973 3:52370463-52370485 CTTGAGGCCCTGGGGATGAAGGG - Exonic
954715753 3:52525918-52525940 GTGGAAGCGCTGGGGGAAACAGG + Intronic
955669300 3:61385604-61385626 CTGGTGGGCAGGGGGAAAACTGG + Intergenic
958953685 3:100443655-100443677 CTAAAATCCCTGGGGAAAACTGG - Intronic
959256976 3:104027861-104027883 CTGAAGGGCATGGGGAAAATTGG - Intergenic
960320463 3:116228829-116228851 CTGGAGGCATTAGGGAAAGCAGG + Intronic
961391899 3:126557375-126557397 GAGGAGCCCCTGGGGAACACGGG + Intronic
961459635 3:127042172-127042194 CAGGAGGCCCTGGTGAAGTCAGG + Intergenic
962437815 3:135382824-135382846 TCAGAGGCACTGGGGAAAACAGG + Intergenic
964414715 3:156435143-156435165 CTAGAAGCCCCAGGGAAAACGGG + Intronic
965007627 3:163045259-163045281 CTGAAGGCCAAGGGGTAAACAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965597688 3:170424193-170424215 CTGGGGACACTGGGGAAAATAGG + Intronic
966388749 3:179429321-179429343 CTGTGGGCACTGGGGAACACCGG + Intronic
966801808 3:183771157-183771179 CTAGAGGCTGTGGGGAAAATAGG - Intronic
967154722 3:186681896-186681918 CTGGAGTCCCTGGAGAAGAAGGG - Intergenic
967919616 3:194604592-194604614 CTGGCTGCCCTGGGGAGAGCTGG - Intronic
968471544 4:784806-784828 CTGGACGGCCTAGGGAAAATGGG + Intergenic
968729888 4:2264684-2264706 CTGGAGCCCCTGGGGGATAGGGG + Intergenic
969531516 4:7733394-7733416 CTGGTGGCCCTGCGGGACACAGG + Exonic
971431812 4:26576427-26576449 CTGCAGCCCCTGGGGAGAAGGGG - Intronic
971587890 4:28428774-28428796 CTAGAGGCCCTAGCTAAAACAGG - Intergenic
971985020 4:33810886-33810908 GTGGGGGCACTGGGCAAAACAGG + Intergenic
973339260 4:48986876-48986898 CTACAGCTCCTGGGGAAAACGGG - Intronic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
977741288 4:100486711-100486733 CTGGCCGCTCTGGGGAGAACAGG + Intronic
979615049 4:122733002-122733024 CTGGAGGTCCTGGGGTGAATTGG + Intronic
980799752 4:137733844-137733866 CTGCAGGCCCTGGGCAATAAGGG + Intergenic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
984523875 4:180833071-180833093 CTGGAGGCTCAGGGGAAAGTAGG + Intergenic
985187788 4:187336221-187336243 CTGCAGGCCCTTGAGAACACTGG + Intergenic
985705305 5:1397117-1397139 CTGGAGGACCTGGGGCAAAGTGG + Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
989909942 5:49621608-49621630 CTTGAGGCCCTCGTGGAAACGGG - Intergenic
990007839 5:50963970-50963992 GTGGAGTCCCTGGGGCGAACTGG - Intergenic
990353401 5:54940973-54940995 CTGGAGGCTCTAGGGAAGAATGG + Intergenic
994211293 5:97089822-97089844 CTGCAGGCCCTGGTGAAAATAGG + Intronic
995417358 5:111925758-111925780 CTGGAGGGCCTATGAAAAACTGG - Intronic
995571945 5:113489945-113489967 TTGGAGACCCTGAGCAAAACTGG + Intergenic
1000067086 5:157703647-157703669 CTGGAGGCTCTGAGGAAAAGAGG - Intergenic
1000503584 5:162085062-162085084 CTGCATGACCTTGGGAAAACTGG - Intronic
1001561003 5:172668886-172668908 CTGAAGGACCTGGGGAATCCCGG - Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1002896281 6:1382273-1382295 CTTGGGGCCCGGGGGAAAAGGGG - Intergenic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1003834223 6:10050626-10050648 CAGAACACCCTGGGGAAAACAGG + Intronic
1005495220 6:26382380-26382402 CGGGAGGCCTTGGGGGAAGCAGG - Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1006894567 6:37458971-37458993 CTGCAGGCCCAGGGTAAAAAGGG - Intronic
1007947399 6:45838580-45838602 CTGGAGACTCTTGGCAAAACTGG - Intergenic
1008569989 6:52807065-52807087 CTGTAGGGCCTGGGGCAGACAGG - Intergenic
1009632048 6:66212769-66212791 CAAAAGGCCCTTGGGAAAACTGG + Intergenic
1013835810 6:114334007-114334029 CAGGAGGACCTGGGGAAACTGGG - Intronic
1014486532 6:122005921-122005943 CTGGAGTCCCTGGAGAAAGTTGG + Intergenic
1015642101 6:135346139-135346161 GTGAAGGTCCTGGGGAAGACAGG + Intronic
1016212943 6:141562378-141562400 TTAGAGGCCCTGGGGAGGACAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018298208 6:162372043-162372065 CTGGAAGCCCAGGAGAAAGCTGG + Intronic
1018614882 6:165677295-165677317 CTGGAGGCCCAGGGAAGAGCTGG - Intronic
1019906330 7:4067903-4067925 CAGGAGCCCCTGGAGAAAAATGG + Exonic
1020341403 7:7115088-7115110 ATGGAGGACCTAGGAAAAACAGG - Intergenic
1021909127 7:25366678-25366700 CCAGAGGCCATGGGGAACACGGG + Intergenic
1022317015 7:29255025-29255047 CTGGAAGACCAGGGGAACACAGG + Intronic
1022396565 7:29992235-29992257 ATGCAGACCCTGGGGAAAGCAGG - Intergenic
1022776612 7:33533490-33533512 TTGGATACCCTGGGGGAAACTGG - Intronic
1023834868 7:44062186-44062208 CAGGAAGCCCTGGCGAAAAGGGG - Intronic
1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG + Intergenic
1025233362 7:57217704-57217726 CTGGAGATCCTGGGGAGAGCCGG + Intergenic
1025302203 7:57826780-57826802 CTGCAAGGCCTGGGGAAGACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026806996 7:73434920-73434942 CAGGAGGGCCTGGAGAACACGGG + Exonic
1029477560 7:100794033-100794055 CAGGAGGCCCTGGGGAGCAGAGG + Intronic
1030806779 7:113929513-113929535 CCGGAGGCCCAGGAGAAAAGTGG + Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032491849 7:132329729-132329751 CTGGGGGCCCTCAGGAAATCTGG + Intronic
1032947753 7:136871247-136871269 AGGGAGTCTCTGGGGAAAACGGG + Intronic
1034412592 7:150949050-150949072 CTGGAGGCCATGGAGAGGACAGG + Intronic
1034938475 7:155214782-155214804 CCGGAGGCGCTGGGGAAGCCGGG + Intergenic
1035534173 8:378538-378560 CTTGAGGCCCTGGAGGAAGCGGG - Intergenic
1038297760 8:26311748-26311770 CTGGAGGAACTGGAGAAAAAAGG - Intronic
1040560515 8:48519752-48519774 CTGGAGGGCCTGGGGTACCCTGG - Intergenic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1045543827 8:103110827-103110849 CTGGTGGCCCTGGGGGTAACAGG + Intergenic
1045613794 8:103881478-103881500 CTGGATGCCTTTGGGAAATCTGG + Intronic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1047498556 8:125425920-125425942 GTGCAGGCGCTGGGGAAATCCGG + Intergenic
1049217549 8:141415075-141415097 CTGGAGGAAATGGGGACAACAGG + Intronic
1049222647 8:141434961-141434983 CTGGGGGCCCTGGGCATACCAGG + Intergenic
1049453668 8:142676190-142676212 CTGGAGTCCCTGGAGGCAACTGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049585971 8:143432519-143432541 CTGGAGGCCCTGGGGCACACTGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1049749880 8:144278040-144278062 CTGGAGACCCTGGAGAATCCGGG - Intronic
1049994002 9:1017539-1017561 CTGCAAGTCCTGGGGAAGACTGG - Intergenic
1050110150 9:2206961-2206983 CTGGTAGCTCTTGGGAAAACTGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053434459 9:38066373-38066395 GTGCAGGCACTGGGGAAACCTGG - Intronic
1053607761 9:39678667-39678689 CTGGAGGCCCTGGAGAGAGAGGG - Intergenic
1053865609 9:42435027-42435049 CTGGAGGCCCTGGAGAGAGAGGG - Intergenic
1054245774 9:62663742-62663764 CTGGAGGCCCTGGAGAGAGAGGG + Intergenic
1054559899 9:66698273-66698295 CTGGAGGCCCTGGAGAGAGAGGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058845388 9:108952759-108952781 CTGGAAGCCCTTGTGAAAAGAGG - Intronic
1059587293 9:115619898-115619920 CTGGAGGCCCAGGAGGAAAAGGG - Intergenic
1060118900 9:120969528-120969550 CTGGAGGCAATGGGGAGACCAGG + Intronic
1061481674 9:130900527-130900549 ATGGAGGCCCTGGGGAAGCCCGG + Intergenic
1061679297 9:132235079-132235101 CTGGGGTCCCTGGTGAAAATGGG + Intronic
1062219810 9:135409185-135409207 CTGGGGGCCCTGGGGACTTCAGG - Intergenic
1062440958 9:136569033-136569055 CAGGAGGGCCTGGGGCAACCAGG - Intergenic
1062724058 9:138061304-138061326 CTAGAGGCCCTGGTTCAAACAGG - Intronic
1203633544 Un_KI270750v1:91904-91926 CTGCAAGGCCTGGGGAAGACTGG - Intergenic
1186426566 X:9467342-9467364 CTGGACGCCCTGCAGAAAACTGG - Intronic
1186732038 X:12420373-12420395 CTGGTGGCACAGTGGAAAACAGG - Intronic
1187172066 X:16861763-16861785 CTGGAGTCTCTGAGGAACACTGG + Intronic
1187306292 X:18098418-18098440 TTTAAGGCCCTGGGGAAAAGAGG + Intergenic
1189908914 X:45790016-45790038 GTTGCGGCCCTGGGAAAAACAGG - Intergenic
1192508513 X:71707068-71707090 CAGGAGGCTCTGGGGAATGCTGG - Intergenic
1192512134 X:71727648-71727670 CAGGAGGCTCTGGGGAATGCTGG + Intergenic
1192514563 X:71753857-71753879 CAGGAGGCTCTGGGGAATGCTGG - Intergenic
1192518184 X:71774485-71774507 CAGGAGGCTCTGGGGAATGCTGG + Intergenic
1192560341 X:72124045-72124067 TTGGAGTCCCTGGGGAGAAGTGG + Intergenic
1193944820 X:87722595-87722617 CTGGTGGACCTGGACAAAACAGG - Intergenic
1194230296 X:91314386-91314408 CTGGAGCCCCTGGAAAATACTGG + Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1197107335 X:122731978-122732000 CTGGAGGTCCTGGGGGGAAAGGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198703342 X:139420299-139420321 CTGGATAACCTTGGGAAAACAGG + Intergenic
1198708513 X:139476107-139476129 CATGAGGGCCTGGGGAAAAAAGG + Intergenic
1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG + Intergenic