ID: 1049629383

View in Genome Browser
Species Human (GRCh38)
Location 8:143644472-143644494
Sequence CTTGCTGGGCAGTGGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049629383_1049629391 2 Left 1049629383 8:143644472-143644494 CCCGGCTCCCACTGCCCAGCAAG 0: 1
1: 0
2: 5
3: 46
4: 426
Right 1049629391 8:143644497-143644519 CCCCAAAGAGAAGGTTCTTGAGG No data
1049629383_1049629389 -7 Left 1049629383 8:143644472-143644494 CCCGGCTCCCACTGCCCAGCAAG 0: 1
1: 0
2: 5
3: 46
4: 426
Right 1049629389 8:143644488-143644510 CAGCAAGAACCCCAAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049629383 Original CRISPR CTTGCTGGGCAGTGGGAGCC GGG (reversed) Intronic
900127623 1:1075501-1075523 GATGCTGGGAAGTGGGAACCAGG + Intergenic
900304922 1:2001014-2001036 CAGGCTGGGCTGTCGGAGCCTGG + Intronic
900621273 1:3588612-3588634 CTCCCTGGGCCGTGGGTGCCTGG + Intronic
900998971 1:6137959-6137981 CTGGTTGGGGAGGGGGAGCCAGG + Intronic
901274474 1:7980493-7980515 CTTGCTGGGCACTGGGGACCAGG - Intronic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902241176 1:15090464-15090486 CATGCCGGTCCGTGGGAGCCGGG + Intronic
903011318 1:20332669-20332691 CTTAGTGGGGAGTGGGAGCAGGG - Intronic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903674656 1:25056215-25056237 CTTGCTGTGCAGTGGGACTATGG + Intergenic
904361358 1:29974672-29974694 CTTGCTGGGCAAGGGAGGCCAGG - Intergenic
904389485 1:30172554-30172576 CTTGCCAAGCAGTGGAAGCCTGG + Intergenic
904600035 1:31668127-31668149 CTTGCTGGGGAGTGGGTGCCAGG - Intronic
904965928 1:34372506-34372528 CTTGGTGGGTAGGTGGAGCCAGG + Intergenic
905324485 1:37141066-37141088 CTTCCAGGCCAGTTGGAGCCAGG + Intergenic
905688999 1:39928953-39928975 CTGGCTGGGCACAGGGTGCCTGG - Intergenic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
912381401 1:109249875-109249897 CTCAGGGGGCAGTGGGAGCCCGG + Intergenic
912480699 1:109980452-109980474 CTCGGTGGGAAGTAGGAGCCAGG + Intergenic
912500669 1:110120042-110120064 CTGGCTCGGCAGCAGGAGCCAGG - Intergenic
914248944 1:145906391-145906413 CACGTTGGGCAGTGGGTGCCAGG + Exonic
915589911 1:156864812-156864834 AGTGCTGGGCAGTGGGAGTTGGG + Intronic
915900050 1:159840388-159840410 TTTGCTGGGGGGTGGGAGCGGGG - Intronic
917631000 1:176891395-176891417 CTTGCTAGGCACTGGGATTCTGG + Intronic
918302134 1:183214237-183214259 CATGCTGGGCAGTGGGAATACGG + Intronic
919606826 1:199693647-199693669 CTTTCTGGGAAGTGGGGGACAGG - Intergenic
919760816 1:201097084-201097106 CCTGCTGGACACTGGGACCCGGG - Intronic
919985919 1:202674854-202674876 CATGCTGGGCAGTGGGGGAGGGG - Intronic
920216245 1:204363236-204363258 CAGGCTGGGCAGTGAGACCCCGG - Intronic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
920809084 1:209265212-209265234 GTTCCTGGTCAGTGGGGGCCAGG + Intergenic
921128001 1:212195335-212195357 CATGCAGGGCAGTGGGGCCCTGG - Intergenic
923328792 1:232903523-232903545 CATGATGGGCAGTGGGAGTCAGG - Intergenic
1063227315 10:4027818-4027840 CCTGCTGGGTGGTGGCAGCCTGG + Intergenic
1063308804 10:4933611-4933633 CCTGGTAGGCAGTGGGTGCCTGG - Intronic
1063550839 10:7031195-7031217 CCTGCTAGACAGTGGAAGCCCGG + Intergenic
1064354549 10:14604997-14605019 CTTGCCGGGGAGACGGAGCCCGG - Intronic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1066442350 10:35450341-35450363 CTTGCAGGGCAGTGGCATCCTGG + Intronic
1066623301 10:37380792-37380814 CTGGCTGGCCTGTGAGAGCCAGG - Intronic
1066685303 10:37976282-37976304 GGTGCTGGGCAGTGGGCGCCCGG - Intronic
1067523477 10:47025146-47025168 AGTGCTGGGAAGTGGGAGTCAGG - Intergenic
1069096215 10:64262868-64262890 AATGCAGGGCAGTGGGAGTCAGG - Intergenic
1069550346 10:69360024-69360046 CGTGCACGGCAGTGGAAGCCAGG + Exonic
1069619393 10:69827280-69827302 CCTACTGGACAGAGGGAGCCGGG - Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070706382 10:78642147-78642169 GTCCCTGGGAAGTGGGAGCCAGG + Intergenic
1070779189 10:79127639-79127661 CTGGCTGGGCCGTGTGACCCTGG - Intronic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1071096505 10:81981560-81981582 CATCCTGGGAAGTGGCAGCCTGG + Intronic
1071292206 10:84195992-84196014 CTTTGTGGGTAGTGGGAACCCGG + Intronic
1071439425 10:85677309-85677331 CTTGCTGGCCACTGTGTGCCAGG - Intronic
1071482931 10:86078697-86078719 CTGGCTGGGCAATGGGAGCCAGG + Intronic
1072449834 10:95531134-95531156 TTTGGTGGGCAGAGGGAGCCTGG - Intronic
1073060751 10:100732118-100732140 CATGCTGGGGAGTGGGTACCAGG - Intergenic
1073331573 10:102673412-102673434 CTTGCTGAGCATTGAGACCCAGG + Intergenic
1073484857 10:103810346-103810368 CCTGCTGGGCTGTGAGGGCCTGG - Intronic
1073598088 10:104819627-104819649 TGTGCTGGGCAGTGGGAGGCAGG + Intronic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1075348069 10:121698991-121699013 CCAGCTGGGCTGTGGCAGCCAGG - Intergenic
1075401153 10:122162737-122162759 CTGACTGGGCACTGGGAGCTTGG + Intronic
1075559890 10:123460677-123460699 GTGGCTTGGCAGTGGGAGCGGGG - Intergenic
1075643788 10:124084484-124084506 CTTGATGGGCAGCAGGAGCTGGG - Intronic
1076144045 10:128102849-128102871 CTTGAAGGGCAGTGGGGGCAGGG + Exonic
1076633629 10:131868528-131868550 CTTGAAGGGCAGCGGGAGGCAGG - Intergenic
1076886250 10:133263930-133263952 ATTCCTGGGCAGTGGCAGCCAGG - Intronic
1077309583 11:1882441-1882463 GTTCTTGGGGAGTGGGAGCCTGG - Intronic
1077374438 11:2198926-2198948 TGAGCTGAGCAGTGGGAGCCAGG + Intergenic
1077474153 11:2778538-2778560 CCTGGTGGGGAGTGGGGGCCTGG - Intronic
1079005633 11:16789617-16789639 CTTGGTGGACAGTGGGTGACAGG + Intronic
1079091707 11:17485295-17485317 CTTACTGGGCTGTGTGAGCTAGG - Intergenic
1079237293 11:18699612-18699634 GTTGCTGGGCATTGTGGGCCTGG + Intronic
1079967242 11:26994375-26994397 CCTGCTGGGGACTGGGGGCCAGG + Exonic
1082081529 11:48016015-48016037 GTTCCTTTGCAGTGGGAGCCAGG + Intronic
1082127840 11:48453733-48453755 CTTGCTGGGCTCTGTGGGCCTGG + Intergenic
1082249580 11:49963688-49963710 CTTGCTGGGCTCTGTGGGCCTGG - Intergenic
1082896004 11:58190734-58190756 CTGGCTGTGCTGTGGGAGCACGG + Exonic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1084025847 11:66448842-66448864 CTTGATGGGAAGTGAGAGTCGGG + Intronic
1084188785 11:67489482-67489504 GAGGCTGGGCAGTGGGGGCCTGG - Intronic
1084363466 11:68683890-68683912 GTCGCTGGGCACAGGGAGCCGGG + Intronic
1084473575 11:69376654-69376676 CTTCCTGGGAAGGGGGTGCCAGG + Intergenic
1086561216 11:88172073-88172095 CTTGCTGGCCTGTGAGTGCCTGG - Intronic
1088727995 11:112656403-112656425 GGTGGTGGGCAGTGGAAGCCAGG - Intergenic
1088865137 11:113840171-113840193 ATTGGTGGGCAGTTGGATCCAGG - Intronic
1089377076 11:118002055-118002077 CCTCCTGGGCAAGGGGAGCCAGG - Intergenic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1090238483 11:125165903-125165925 CTTCCTGGGGATCGGGAGCCAGG - Intronic
1090239365 11:125171211-125171233 CTTGCTGGGGAGGGGCAGCATGG + Intronic
1090868155 11:130720429-130720451 CACACTGGGCACTGGGAGCCAGG - Intergenic
1093256420 12:16873557-16873579 CCTGTTGGGGAGTGGGGGCCTGG - Intergenic
1093418399 12:18947024-18947046 CATGCTGGTCAGTGTGAGCGTGG - Intergenic
1095849609 12:46787959-46787981 CATCATGGGCAGTGGGATCCTGG - Exonic
1095948151 12:47765565-47765587 CCTGCTGGGCCCTGGGGGCCAGG + Intronic
1097857458 12:64479380-64479402 CTTCCTCAGCAGTGGCAGCCAGG - Intronic
1098362896 12:69672444-69672466 CCAGCTGGACACTGGGAGCCTGG - Intronic
1098569060 12:71968570-71968592 CTTACTGGGCAGCAGGATCCAGG - Intronic
1098883510 12:75940689-75940711 TTTGCTGGGAAGACGGAGCCAGG + Intergenic
1099658655 12:85527517-85527539 CTGGCAGGGCAATGGGACCCTGG - Intergenic
1101217241 12:102596511-102596533 CTTGATGGGCAGTTGGGGACTGG + Intergenic
1101940957 12:109098453-109098475 CCGGCTGGGCAGGAGGAGCCTGG + Exonic
1102432865 12:112897270-112897292 CTCAGGGGGCAGTGGGAGCCCGG - Exonic
1103459292 12:121090924-121090946 CTGGCTGGGCAGTGGCTGCAGGG + Intergenic
1103792067 12:123478893-123478915 CTTCCTGGGCAGTGCCAGCCTGG + Intronic
1103903680 12:124316427-124316449 CCTGCTCCGCAGTGGCAGCCAGG - Intergenic
1104781817 12:131426460-131426482 CATGATGGGAAGGGGGAGCCAGG + Intergenic
1106190800 13:27450726-27450748 CCTGCGGAGCAGCGGGAGCCAGG - Intergenic
1106546000 13:30731707-30731729 CTTTCTGGGCAATGGGAGGGGGG + Intronic
1111123252 13:83880673-83880695 CTTCTTGGGCAGGGGGCGCCGGG + Exonic
1112004925 13:95245793-95245815 CACGGTGGGCAGTGGGAGGCAGG - Intronic
1113375882 13:109765437-109765459 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113375893 13:109765486-109765508 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113375904 13:109765535-109765557 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113375926 13:109765633-109765655 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113375960 13:109765780-109765802 CTTGGTGGGGAGTCGGAGTCAGG - Intronic
1113375971 13:109765829-109765851 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113376006 13:109765976-109765998 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376018 13:109766025-109766047 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376029 13:109766074-109766096 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113376051 13:109766172-109766194 CTTGGTGGGGAGTCGGAGTCAGG - Intronic
1113376074 13:109766270-109766292 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376085 13:109766319-109766341 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113376096 13:109766368-109766390 CTTGGTGGGGAGTCGGAGTCAGG - Intronic
1113376107 13:109766417-109766439 CTTGGTGGGGAGTCGGAGTCAGG - Intronic
1113376119 13:109766466-109766488 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376130 13:109766515-109766537 CTTGGTGGGGAGTCGGAGTCAGG - Intronic
1113376153 13:109766613-109766635 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376176 13:109766711-109766733 CTTGGTGGGGAGTCGGAGCCAGG - Intronic
1113376187 13:109766760-109766782 CTTGGTGGGGAGTTGGAGTCAGG - Intronic
1113555487 13:111230588-111230610 CTTGCTGGGGTCTGGCAGCCAGG + Intronic
1116341723 14:43731729-43731751 CTTCCTTGGCAGTGTGAGCCTGG - Intergenic
1117498642 14:56330639-56330661 CTGGATGGGCTGAGGGAGCCTGG - Intergenic
1118208564 14:63745990-63746012 TTTGGTGGGCAGTGGGGGCTAGG + Intergenic
1118593723 14:67420160-67420182 CTTTCTGGGCAGTGCCTGCCTGG - Intergenic
1118984533 14:70742313-70742335 CTGGCTGGGAAGTGGGAGCAGGG - Intronic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119385844 14:74257742-74257764 CTTCCTGGGGAGCGGGAGCTGGG - Intronic
1119415657 14:74467711-74467733 CTGGCAGGGCAGTAGGAGCATGG + Intergenic
1119674801 14:76545893-76545915 CTTGCTGGGCGTTGGGAAGCAGG + Intergenic
1121329526 14:93041214-93041236 CTGGCCGGGCAGTGGAAGCCTGG - Intronic
1121909651 14:97777273-97777295 CCTGCAAGGCTGTGGGAGCCGGG + Intergenic
1122370184 14:101225316-101225338 CTTGCTGGGCACAGGCTGCCTGG + Intergenic
1122599379 14:102913704-102913726 CTTGCAGGGAATTGGGAACCAGG + Intergenic
1122599458 14:102914062-102914084 ACTGCAGGGCAGTGTGAGCCGGG - Intergenic
1122693588 14:103542569-103542591 CTGCCTGGGCAGTGTGACCCTGG - Intergenic
1122886357 14:104712146-104712168 CTTCCAGGGCAGGTGGAGCCCGG - Intronic
1123073200 14:105652206-105652228 CTTGCTGGGCTGGAGGGGCCGGG + Intergenic
1123089805 14:105737521-105737543 CATGCAGGGCACTGGGGGCCAGG - Intergenic
1126787644 15:52191207-52191229 CTTTCTGTGCGGTGGGAGCATGG - Intronic
1128163653 15:65441755-65441777 TTTCCTGGGCAGTAGGGGCCGGG + Intergenic
1128724666 15:69979508-69979530 CTTGCTGGGAGGTGGAGGCCAGG - Intergenic
1129642184 15:77392076-77392098 CTTCCTGGGCAGTGAGATACAGG + Intronic
1129661196 15:77554036-77554058 CTTGAAGGGCAGTGGGCCCCAGG - Intergenic
1131250499 15:90827181-90827203 CTTCGTGTGCAGTGGGAGCCTGG + Intergenic
1131508690 15:93037026-93037048 CGAGCTGGGCAGTGGGTGACTGG + Intronic
1131781489 15:95864380-95864402 CTTGCTAGGAAGTAGGAACCTGG - Intergenic
1132675791 16:1120817-1120839 CTTGCTTGGCAGTGGGGGTCCGG - Intergenic
1132755274 16:1481485-1481507 CATGCTGGGGAGGGGAAGCCAGG + Intergenic
1132903395 16:2270228-2270250 CCTGGTGGGCAGGGGCAGCCTGG + Intergenic
1133022364 16:2972413-2972435 GTCTCTGGGCAGAGGGAGCCAGG - Exonic
1133372368 16:5254987-5255009 CATGCTGGGCAGGTAGAGCCAGG - Intergenic
1134060636 16:11197668-11197690 CTTGCAGGTCAGTGGGGTCCTGG - Intergenic
1135047044 16:19164518-19164540 CTTGCAAAGCAGTGGGATCCTGG + Intronic
1136043144 16:27596048-27596070 CTCTGGGGGCAGTGGGAGCCAGG + Intronic
1136279409 16:29199172-29199194 TGAGCTGGGCATTGGGAGCCAGG - Intergenic
1136514874 16:30762082-30762104 CAGGCTGGGAAGTGGGAGCGCGG + Exonic
1136867247 16:33768145-33768167 CATGCCAGGCAGTGGAAGCCAGG - Intergenic
1137720610 16:50625415-50625437 CTGACTGGGTAGTGGAAGCCTGG - Intronic
1138346290 16:56322306-56322328 CTTGCTGGTCAGAGCGTGCCTGG - Intronic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139700972 16:68707803-68707825 CTTGCTGGGCAGTGGGTACAGGG - Intronic
1140210969 16:72969945-72969967 CCTTCTGGGCAGTGGGCGTCCGG - Intronic
1140224101 16:73065083-73065105 CTTGCTTGCCAGCCGGAGCCAGG + Intergenic
1141112127 16:81278505-81278527 CTTCCTGGGCACTAGGTGCCAGG + Intronic
1141172961 16:81702641-81702663 CTTGGAGGGCAGTGTTAGCCTGG - Exonic
1141944402 16:87299347-87299369 CTCGCTGCGCAGTGGCACCCTGG + Intronic
1142083799 16:88165273-88165295 TGAGCTGGGCATTGGGAGCCAGG - Intergenic
1142112852 16:88341397-88341419 CGTGCTGGGCAGCGTGAGGCAGG + Intergenic
1142260771 16:89041596-89041618 AGTGCTGGGAAGTCGGAGCCAGG - Intergenic
1203104915 16_KI270728v1_random:1348058-1348080 CATGCCAGGCAGTGGAAGCCAGG + Intergenic
1203128599 16_KI270728v1_random:1614310-1614332 CATGCCAGGCAGTGGAAGCCAGG - Intergenic
1142900713 17:3009748-3009770 GCTGATGGACAGTGGGAGCCCGG + Intronic
1143291965 17:5838192-5838214 GTGGCTGGGCATTGGGGGCCTGG - Intronic
1144933988 17:18883037-18883059 CTTGCTGGGAGGTGGGATCATGG - Intronic
1146667804 17:34716435-34716457 CTTGGAGGGAAGTGGGGGCCAGG - Intergenic
1146806432 17:35868574-35868596 CTTGCCTGGGAGTGAGAGCCAGG + Intronic
1146913074 17:36660459-36660481 CTTGCTTGGCTCTGAGAGCCAGG + Intergenic
1147324384 17:39663341-39663363 CTTGTTGGGGAGTGGGTGGCAGG + Exonic
1147446578 17:40478522-40478544 CTTGGTGGGCAGCGGGGCCCTGG + Intronic
1147889186 17:43704962-43704984 CTTGCGGGGTAGAGGGAGGCTGG - Intergenic
1148075113 17:44931270-44931292 CTTGCTGTGGAGGGGCAGCCTGG + Intronic
1148324634 17:46776180-46776202 CCTGCTGGGCAGTGCCTGCCTGG + Intronic
1148784999 17:50141807-50141829 CTGTGTGGGCAGTGAGAGCCAGG + Intronic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1149656529 17:58312181-58312203 GTTGCTTGGCGGTGGGTGCCCGG - Exonic
1151433757 17:74081663-74081685 TATACTGGGCAGTGGGAACCAGG - Intergenic
1151467643 17:74297887-74297909 CTTCTTCGGGAGTGGGAGCCAGG + Intronic
1152229292 17:79106524-79106546 CTCCCTGCGCAGTGGGAGGCAGG + Intronic
1152341816 17:79729849-79729871 CATGCCAGGCAGTGGAAGCCAGG - Intergenic
1152404784 17:80091015-80091037 CTGGCTGAGGAGGGGGAGCCGGG - Intronic
1152448853 17:80363743-80363765 CATGCAAGGCAGCGGGAGCCTGG + Exonic
1152579194 17:81158599-81158621 CCAGCTGGCCTGTGGGAGCCAGG - Intronic
1152602633 17:81272472-81272494 GTTGCCGGGGAGTGGGACCCGGG - Intronic
1152661324 17:81543649-81543671 CTGGCTGGGCAGAGGCTGCCTGG - Intronic
1152727081 17:81952775-81952797 CTGGCTGGGCTGTGGGAGAGGGG + Exonic
1152744441 17:82032327-82032349 CTTGCTGGGCAGAGGGTCCGAGG + Intronic
1152906598 17:82973953-82973975 CTTGCTGGTCAGTGGCAGGCGGG - Intronic
1153978241 18:10287978-10288000 CCTGCTGGGCAGTCAGAGCCAGG - Intergenic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1156005780 18:32439179-32439201 CTTGCTGGGCACTGAAAGCCTGG + Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157578433 18:48759179-48759201 CCTGCTGGGCAGTGGGGTCGGGG - Intronic
1157815211 18:50725134-50725156 AGTTCTGGGCAGTGGGAACCTGG - Intronic
1158023441 18:52869764-52869786 CTGGCTGGGCTGTGACAGCCCGG + Intronic
1158118900 18:54026448-54026470 CATGCTGGGGACTGGGAGTCAGG + Intergenic
1160054966 18:75470496-75470518 CCTGCTGGGGACTGGGAACCTGG + Intergenic
1160412986 18:78687638-78687660 ATGGCTGGGCAGTCAGAGCCCGG - Intergenic
1160688322 19:447932-447954 TTTGCTGGGAGCTGGGAGCCAGG + Intronic
1160846601 19:1168791-1168813 CTTGCTGGGGAGGGGCAGCCAGG - Intronic
1161256903 19:3314771-3314793 CTTGCTGGACACGGGGGGCCCGG - Intergenic
1161718936 19:5892677-5892699 CCTGCTGGGCAGTGTGGACCCGG - Exonic
1161723565 19:5916314-5916336 CTTGCTGGGGGCTGGGGGCCAGG + Exonic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162175136 19:8824668-8824690 CTTGCTGGGCAGTTCTGGCCTGG + Intronic
1162731321 19:12720843-12720865 CTTCCGGGGCTGGGGGAGCCGGG - Intronic
1162998049 19:14348782-14348804 CTAGCTGGGAAATGGCAGCCGGG - Intergenic
1163250826 19:16125359-16125381 CTGGCTGTGCAGTGGGTGCTGGG + Intronic
1163382201 19:16976547-16976569 CTTGGTGGGCAGGGGGTGCATGG - Intronic
1163420679 19:17212078-17212100 CTCGCTGGGCACCGGGTGCCCGG + Exonic
1164473725 19:28556444-28556466 GGTTCTGGGAAGTGGGAGCCTGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165103724 19:33456477-33456499 CTTGCTTGGCTGTTGGAGACGGG - Intronic
1165188484 19:34042099-34042121 CCTGCTGGTGAGTGGCAGCCAGG - Intergenic
1165281137 19:34798490-34798512 GATGCTGGACAGTGGGAGCCAGG - Intergenic
1166048999 19:40246993-40247015 TAGGGTGGGCAGTGGGAGCCAGG - Intronic
1166545577 19:43632938-43632960 TTAGCTAGGCAGTGGTAGCCCGG + Intronic
1167120207 19:47512285-47512307 CTTGCTGGGGAGTGGGGCCGGGG - Intronic
1167498094 19:49830851-49830873 CGGGCTGTGCCGTGGGAGCCAGG - Exonic
1167738850 19:51312085-51312107 CTGGCTGGGCAGGGGGACCTCGG + Intronic
1168102247 19:54147467-54147489 GCTGCTTGGCAGTGGGGGCCTGG - Intronic
925151555 2:1618737-1618759 CTTGCTGTGCAGTGAGCACCAGG + Intergenic
925686221 2:6476511-6476533 GATGCTGTGCAGTGGGCGCCTGG - Intergenic
925715431 2:6780551-6780573 CTTTCTGAGGAGTGGGACCCTGG - Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927849350 2:26489256-26489278 CCTGCTGCGCAGTGGCACCCTGG - Exonic
927871103 2:26624326-26624348 CTTGCTGGGAGGTGGGGGCCCGG - Intronic
930217006 2:48707797-48707819 CTTGCTGGGCTCTGTGAGCATGG + Intronic
932012285 2:67990637-67990659 CTTGCTGTCTAGTGGGATCCTGG - Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
934916377 2:98304141-98304163 CTTGCTGGGAGGTGGGAGCAAGG + Intronic
935068904 2:99676412-99676434 CTTCCTGGGCAGTGTGACGCTGG - Intronic
936153275 2:110033086-110033108 CCTCCTGGGCAGTGGAAACCTGG + Intergenic
936191406 2:110338329-110338351 CCTCCTGGGCAGTGGAAACCTGG - Intergenic
936847253 2:116852447-116852469 GTTGCTGGCCAGTGTGAGTCTGG - Intergenic
937045417 2:118848656-118848678 CTTCCCTGGCAGTGGGAGTCCGG + Intergenic
937892400 2:126948594-126948616 CATGCTTGGTAGGGGGAGCCTGG - Intergenic
938072498 2:128316080-128316102 CTCCCTGGGCAGGGGGAGCCGGG + Intronic
938229925 2:129649654-129649676 CTTGCTAGGAAGTGGCATCCTGG + Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
946375879 2:219308800-219308822 ATCTCTGGGCAGTGGAAGCCTGG - Intronic
948540344 2:238686842-238686864 CGTGATGTGGAGTGGGAGCCCGG + Intergenic
948752322 2:240139807-240139829 CACACTGGGCAGGGGGAGCCAGG - Intronic
948775269 2:240284720-240284742 CTGTGTGGGCAGTGGGACCCGGG + Intergenic
948897333 2:240933587-240933609 CTTGGTGGGCATTGGGGGCTGGG - Intronic
948975425 2:241460792-241460814 GTGGCAGGGCTGTGGGAGCCAGG + Intronic
1168802501 20:652543-652565 TGTGCTGGGCAGTGGGGCCCAGG + Intronic
1169386145 20:5151065-5151087 CTGCCTGGGCAGTGAGAACCAGG + Intronic
1169505532 20:6207819-6207841 CTTGCAGGGGAGAGGGAGCATGG + Intergenic
1170376589 20:15707401-15707423 CTTGCTGGGCACTGGGAATATGG + Intronic
1170605939 20:17875184-17875206 CTTACTGAGCACTGGGGGCCTGG + Intergenic
1172046388 20:32083743-32083765 CTGAGTGGGCTGTGGGAGCCAGG - Intronic
1172630002 20:36371849-36371871 CTTCCTGGGAAGTGGGGGCATGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174387428 20:50195373-50195395 CTAGCTGGGAGGTGGGAGCCTGG + Intergenic
1174677420 20:52371881-52371903 CTGCCTGTGCAGTGGGAGACTGG - Intergenic
1175218703 20:57404913-57404935 CTGGGTGTGCAGTGGAAGCCAGG + Intronic
1175887058 20:62298091-62298113 CTTGGTGAGCTTTGGGAGCCAGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176112989 20:63418951-63418973 CTTGCTGGGCTGTGCTGGCCAGG + Intronic
1176135390 20:63520185-63520207 ATGGCGGGGCAGTGGGAGGCGGG - Intergenic
1179711300 21:43264789-43264811 CTTGCTGGCCAGGGAGAGACTGG - Intergenic
1180063689 21:45402463-45402485 CTTCCTGGGCAGGTGGGGCCTGG - Intergenic
1180635163 22:17258134-17258156 CTTTCTGGGCAGGGGGAGGGAGG + Intergenic
1180867323 22:19127023-19127045 CCCACTGGGCAGTGGGAGCCAGG - Intergenic
1181086585 22:20442365-20442387 CCTGCTGGGCACGGTGAGCCTGG - Exonic
1181513314 22:23398434-23398456 CCTGCTCTGCACTGGGAGCCCGG + Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182396642 22:30040959-30040981 CTTGCAGGGGAGTGGGAGTCTGG - Intergenic
1182626153 22:31648096-31648118 CTTGCTGGTCACTGGGAGGTAGG - Intronic
1183309335 22:37101022-37101044 GTTGGGGGGCAGAGGGAGCCAGG + Intronic
1183689049 22:39377786-39377808 CATGCAGGGCAGTGGAAGGCTGG + Intronic
1183786297 22:40030948-40030970 CTGGCTGGGCTGTGGGAGCCAGG + Exonic
1184040612 22:41940998-41941020 TTTGCTGAGCTCTGGGAGCCTGG - Intronic
1184275030 22:43405191-43405213 GATGCTGGGCAGGGTGAGCCGGG + Intergenic
1184357000 22:43988618-43988640 CTCGCTGTGCAGTGGGTGGCAGG + Intronic
1184425845 22:44408928-44408950 CTTACTGGGCTGTGGGAGGATGG - Intergenic
1184859890 22:47167483-47167505 CTTGCTGAGCTGTGGGCGGCAGG - Intronic
1185030095 22:48438172-48438194 CTTGCTGGGCATTGCCAGGCTGG - Intergenic
1185094604 22:48799549-48799571 CCTGCTGGGCCCTGGGAGCAGGG - Intronic
1185280424 22:49967488-49967510 CTGGATGGGCGGTGGCAGCCTGG - Intergenic
1185297372 22:50061033-50061055 CTTCCTGGACAGTGAGAGCAGGG - Exonic
949985598 3:9538186-9538208 CTTGATGGGAGGAGGGAGCCCGG - Intronic
950131709 3:10551855-10551877 CTTCCTGGGCTGTGGGAAGCAGG + Intronic
950906659 3:16544986-16545008 CTTGCTGTGCGGTGGGTGCCTGG + Intergenic
952992642 3:38845000-38845022 TTTGCTGGGCAGTGTGGGGCAGG + Intergenic
953018907 3:39101358-39101380 ATAGCTGGGCAGCTGGAGCCAGG - Intronic
953660094 3:44885570-44885592 CTTTCTGGTCAGTCTGAGCCAGG + Intronic
953752252 3:45617786-45617808 CTTGCTGGGGAGCGGGAGGACGG + Intronic
953932039 3:47010246-47010268 CTTGCTGAGCGGAGGGAGCCGGG + Intergenic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954806355 3:53223210-53223232 CATGCTGGGCAGTCGGGGCCTGG - Intergenic
954853095 3:53619643-53619665 CTTCCTCGGCATTGGGACCCTGG + Intronic
954869718 3:53758523-53758545 CCTGCTGGACAGTGGGCTCCTGG - Intronic
955228517 3:57079582-57079604 CTGGCGGGACAGTGGGAGCGAGG - Intergenic
955800430 3:62680691-62680713 CTTCATGGACAGTGGGAGACAGG - Intronic
957952505 3:87144553-87144575 CTTGCTGGGATTTGGGTGCCTGG - Intergenic
961457017 3:127029365-127029387 CCAGCCGGGGAGTGGGAGCCTGG + Intronic
962275706 3:134011848-134011870 GTTGCTGAGCAGTGAGAGCTGGG + Intronic
965523000 3:169687618-169687640 CTTGCTGTGGTGTGGTAGCCGGG - Intergenic
967970501 3:194995567-194995589 CTTCCAGGCCAGTGAGAGCCAGG + Intergenic
967972055 3:195006296-195006318 GTGGGTGGGCGGTGGGAGCCCGG - Intergenic
968636679 4:1684470-1684492 CTCGGTGGGCGGTGCGAGCCTGG - Intergenic
968665253 4:1817863-1817885 ATTGCTTGGGAGTGGGAGGCTGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969309816 4:6346749-6346771 TTTGCTGGGCAGTCAGAGACAGG - Intronic
969477634 4:7430580-7430602 CTTGCTCGGCTCTGGCAGCCCGG + Intronic
969582095 4:8071546-8071568 CTCGGCTGGCAGTGGGAGCCTGG + Intronic
969798881 4:9547073-9547095 CATGCTGGGCAGGTAGAGCCAGG - Intergenic
970512508 4:16795207-16795229 CTTGCTGTGAAGAGAGAGCCTGG + Intronic
971161294 4:24136762-24136784 CATGCTGAGTAGTGGGAGTCAGG - Intergenic
971349286 4:25842375-25842397 CTTCGTGGGCAGGGGGAGTCGGG + Intronic
972670914 4:41213870-41213892 CCTGCCGGGGAGTTGGAGCCGGG - Intronic
973207043 4:47572334-47572356 CTAGCTGAGGAGTGGGAGACAGG + Intronic
973724728 4:53763943-53763965 CCAGCAGGGCAGTGGGGGCCAGG - Intronic
973848489 4:54937287-54937309 CCTGCTGGGAAGTGGCAGGCTGG + Intergenic
975473256 4:74794230-74794252 CGTGCTGGGCACTGGAAACCAGG - Intronic
976235302 4:82890804-82890826 CTTGCCGGGGAGTAGTAGCCGGG - Intronic
977133093 4:93267461-93267483 CTTGCTAGGCTGTGGAAACCAGG - Intronic
977477816 4:97536085-97536107 GTTGCTGGGCAGTCTGAGGCAGG - Intronic
978410157 4:108417035-108417057 AATGCTGGGAAGTGGGAGACGGG + Intergenic
979953264 4:126921828-126921850 CCTGCTGGGCAGTGGGGTCTAGG + Intergenic
983981865 4:174007817-174007839 ATCCCTGGGCAGTGGGAGGCAGG - Intergenic
984250082 4:177321216-177321238 CTTGGTGGGCAGTGGGAGTGGGG - Intronic
985259012 4:188097681-188097703 CTGGGAGGGCAGTGGGAGCCAGG + Intronic
985425759 4:189828653-189828675 ATGGCAGGGCAGAGGGAGCCTGG - Intergenic
985493475 5:192263-192285 CTTGGTGGGCAGGGTGAGCGAGG - Exonic
985722836 5:1499651-1499673 CTTGCTGGGTAGTGGTGACCTGG - Intronic
985967848 5:3351285-3351307 CTTGCTGGACAGGGGGACCCAGG - Intergenic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
986632079 5:9783464-9783486 CGTGCTGGGCCCTGGGAGCTGGG + Intergenic
986806776 5:11314772-11314794 CTTCAGGGGTAGTGGGAGCCAGG - Intronic
988485828 5:31667487-31667509 CTTGCTGGATAGTGGGGGCTGGG + Intronic
990439415 5:55829818-55829840 CTTTCTGTGCATTAGGAGCCTGG + Intergenic
991673937 5:69074510-69074532 CTGGCTGGGCAGAAGGATCCCGG - Intergenic
992366092 5:76091447-76091469 CATTCTGGGCAGTGAGAGGCAGG - Intronic
993969919 5:94406725-94406747 CTTGCTGAGGAATGGGAGCTGGG - Intronic
995533041 5:113109885-113109907 GTTGCATGGCAGTGGGGGCCAGG - Intronic
997598997 5:135126790-135126812 TTTCCTGGGCAGTGGGCGGCGGG + Intronic
997693520 5:135843914-135843936 CTTGGTGGGCTCTGGGACCCAGG - Intronic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
999459464 5:151745450-151745472 CTACATGGGCAGTGGCAGCCAGG + Intronic
1000242648 5:159422923-159422945 GTAGGTGGGCAGAGGGAGCCAGG - Intergenic
1001485971 5:172119922-172119944 CTTGCTGGGCAGCAGGGGCAGGG + Intronic
1002102512 5:176864397-176864419 CGTGCTGGGCACAGGGAGACTGG + Intronic
1002180348 5:177428026-177428048 CTTGGTGGGCACGGGGTGCCAGG - Intronic
1002425995 5:179176305-179176327 CTTGCTGCCTAGGGGGAGCCTGG - Intronic
1002493921 5:179599220-179599242 CTTCATGGGCCCTGGGAGCCAGG + Intronic
1002537843 5:179887929-179887951 GTTGCTGGGCAGTGTGGGTCTGG + Intronic
1002598474 5:180339679-180339701 TTTCCTGAGCAGTGGGAGCGAGG - Intronic
1002919946 6:1560949-1560971 CTTGCTGGAAATTGGGAGCCAGG + Intergenic
1005441624 6:25875381-25875403 CTGGCTGAGAAGTGGGAGCCTGG + Intronic
1005597580 6:27394281-27394303 GGTGCAGGGCAGTGGGACCCAGG - Intronic
1011075279 6:83431434-83431456 CTTCCCGGGCAGGGGGATCCTGG - Intergenic
1011271573 6:85585229-85585251 CCTGCTGGGGAGTGGGGGACTGG + Intronic
1013596397 6:111664616-111664638 TTTCCTGGGCATTTGGAGCCAGG + Intronic
1014698649 6:124655974-124655996 CTTGCTGGGCTGTCCAAGCCTGG + Intronic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017760237 6:157562868-157562890 CTTGGGGGGCGGTGGGAGGCGGG - Intronic
1018581739 6:165313881-165313903 CTTGCTGGGGAGTTGGGGCGTGG - Intergenic
1018866069 6:167747956-167747978 TTTGCTGGGGAGAGGGAGTCGGG - Intergenic
1019048153 6:169163536-169163558 CTGGCTGGGGAGTGGGAACTGGG + Intergenic
1021072385 7:16256756-16256778 CTTGTTGGGGAGTGGGGGGCTGG + Intronic
1021604944 7:22400669-22400691 CTTGCTGGAGAATGAGAGCCAGG + Intergenic
1022776737 7:33534667-33534689 CTTGCTGGCCCATGGGTGCCTGG - Intronic
1026907159 7:74069115-74069137 CCTGGTGGGCAGGGGGAGCTGGG - Intronic
1028207202 7:88031781-88031803 TGTGCAGGGCAGTGGGACCCTGG - Intronic
1028338793 7:89692536-89692558 CTGGCAGGGCAGCTGGAGCCTGG + Intergenic
1029221684 7:98995319-98995341 CTGGCGGGCCAGTGGGAGACAGG + Intronic
1029478671 7:100800167-100800189 CTTGCTTGGAAGTGGGGGCTGGG + Intergenic
1032084556 7:128877164-128877186 CCTGCAGGGCACTGGCAGCCGGG + Exonic
1033607691 7:142939569-142939591 CCTGCTGGGCACTGGGAGCAGGG + Exonic
1034273329 7:149813651-149813673 CCTGGTGGGCAGTAGCAGCCAGG - Intergenic
1034890257 7:154833212-154833234 CTGGCAGGGCACTGGGACCCCGG - Intronic
1034982947 7:155490153-155490175 CTTGCCAGGCAGTGGGAGAGAGG + Intronic
1035079025 7:156200817-156200839 CTAGCTGAGCAGGGGGAGCAGGG + Intergenic
1035185840 7:157125405-157125427 ATTGCTGAGAACTGGGAGCCTGG + Intergenic
1035534657 8:381879-381901 GTTTCAGGGAAGTGGGAGCCTGG - Intergenic
1035566534 8:644861-644883 CTTGCTGGGAAGTGGGTGCAGGG - Intronic
1036136803 8:6169495-6169517 CTTGCAGGGAAAGGGGAGCCAGG - Intergenic
1036213928 8:6863632-6863654 CTGGCGGGGACGTGGGAGCCTGG + Intergenic
1036388668 8:8305754-8305776 CTTTCTGGATAATGGGAGCCAGG + Intergenic
1036662001 8:10714810-10714832 ACGGCTGGGGAGTGGGAGCCTGG - Intergenic
1037459370 8:19093931-19093953 AGTGCTGGGCAGTGAGAGACAGG + Intergenic
1037507013 8:19540756-19540778 CTTCCTGGGCAAAGGGAGCAGGG - Intronic
1039816343 8:41097910-41097932 CGTTCTGGGAAGTGGGAGACAGG + Intergenic
1041072078 8:54135295-54135317 CTTGCAGGGCGGTGGGGCCCGGG + Exonic
1044526588 8:93259575-93259597 CTTCCTAGGGAGTGGGACCCAGG + Intergenic
1045124327 8:99072527-99072549 CTTGTTTGGCAGGTGGAGCCAGG + Intronic
1047521045 8:125595678-125595700 CTGGTTGGGCAGGGGCAGCCAGG + Intergenic
1048496915 8:134943017-134943039 CATGTGGAGCAGTGGGAGCCAGG + Intergenic
1048522591 8:135170756-135170778 CAAGCTTGGCAGTGGGAACCAGG + Intergenic
1048589025 8:135803818-135803840 CCTGTTGTGCAGTGGGGGCCGGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049629383 8:143644472-143644494 CTTGCTGGGCAGTGGGAGCCGGG - Intronic
1051174354 9:14347858-14347880 CTTGCTGGGCGGCGGGATACTGG - Intronic
1051720203 9:20029058-20029080 ATTGCTGGGAAGTGGGAGGAAGG - Intergenic
1052934886 9:34084812-34084834 CTGGCTGGAAAGTGGGAGCAAGG + Intergenic
1053112384 9:35472997-35473019 CTTACTGGGAACTGGGAGCTAGG + Intergenic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057208981 9:93189380-93189402 CTTGCTGGGCCCTGGGAGAGCGG + Intronic
1057277677 9:93684636-93684658 CTGGCTGGACAGTGGGGCCCAGG - Intergenic
1057851887 9:98572391-98572413 CTTGCTGGACAGAGACAGCCAGG - Intronic
1058590326 9:106558311-106558333 CTTGCTTGGCTGTCAGAGCCAGG - Intergenic
1058876372 9:109248471-109248493 CTGGCTGGTCAGTGGGAGCCAGG + Intronic
1059350110 9:113658460-113658482 CTCGCTGGGCAGTGGGGCACTGG - Intergenic
1059417080 9:114168853-114168875 GGTGCTGGGCGGTGGGGGCCTGG - Exonic
1060406340 9:123374873-123374895 GCTGCTGGGCAGTGGTTGCCTGG + Intronic
1060600926 9:124876818-124876840 CTGGCTGGCCAAGGGGAGCCTGG - Intronic
1061249837 9:129420286-129420308 CTAGGTGGGCAGAGGGAGCCGGG + Intergenic
1061405920 9:130393054-130393076 CTTGCTGGCCAGAGGGGGCGGGG - Intronic
1061413123 9:130431648-130431670 CTGGCGTGGCTGTGGGAGCCTGG - Intronic
1061899226 9:133664468-133664490 CTTGCTGGGGAGCCCGAGCCAGG - Intronic
1062002842 9:134225457-134225479 TCTGCTGGGCAGTGGGAGGTGGG + Intergenic
1062027765 9:134348389-134348411 GATGCAGGGCAGTGAGAGCCAGG + Intronic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062312743 9:135948033-135948055 CTTGATGAGCTGGGGGAGCCTGG + Intronic
1062353116 9:136148725-136148747 CTTGCTGGGCAGCAGGGGCTGGG + Intergenic
1062462426 9:136667492-136667514 CTGGCTGTGCAGCAGGAGCCAGG - Intronic
1062551582 9:137089910-137089932 CTTGGTGGGCAGGTGGTGCCAGG + Intronic
1062558299 9:137127270-137127292 CTTGGTGGGCAGGTGGTGCCGGG - Intergenic
1062610531 9:137371482-137371504 CTTGCTGGGAAGAGGAACCCAGG + Intronic
1203786837 EBV:132972-132994 CGTGCTGGGCAGTCAGGGCCTGG + Intergenic
1185632875 X:1528352-1528374 CTTGCTGGAGAGTGGGTTCCTGG + Intronic
1186785514 X:12953116-12953138 ATTGTTGGGAAGTGGGAGCTAGG - Intergenic
1188159638 X:26784020-26784042 CCAGTTGGGCAGTCGGAGCCTGG + Intergenic
1189284929 X:39845254-39845276 CTTGAGTGGCAGTGGGAGTCAGG + Intergenic
1189986958 X:46562021-46562043 CTTGAAGGGCAGTGGGGGCAGGG + Intergenic
1190116580 X:47629508-47629530 CTTGCAGGTTAGGGGGAGCCTGG - Exonic
1190474675 X:50814343-50814365 ATCGCTGGGGAGTGGGAGCGAGG + Intergenic
1190840750 X:54142230-54142252 CTTGTTGGACAGTGGGTGCTGGG + Intronic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195625913 X:107005759-107005781 ATTGCTGGGCAGTGGCAGCAGGG - Intergenic
1196614371 X:117750909-117750931 CCTGATGGGTAGTGGAAGCCTGG - Intergenic
1196766747 X:119252895-119252917 CTTCCTTGGCAGTGGGAGGGAGG - Intergenic
1197277132 X:124492804-124492826 CTGGTGGGGCAGTGGGAGGCAGG + Intronic
1200236751 X:154471415-154471437 CTGGCTGGGCAGTGAGGGCAGGG + Intronic
1200252057 X:154559046-154559068 CTCGCAGGGCAGCGGGAGGCTGG - Intronic
1200265711 X:154645370-154645392 CTCGCAGGGCAGCGGGAGGCTGG + Intergenic
1200982345 Y:9273718-9273740 CCTGCTGGGCAGTGTGGGGCTGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1202128061 Y:21586012-21586034 CCTGCTGGGCAGTGTGGGGCTGG + Intergenic
1202273017 Y:23088530-23088552 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202293009 Y:23332152-23332174 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic
1202426014 Y:24722274-24722296 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202444775 Y:24947812-24947834 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic