ID: 1049632683

View in Genome Browser
Species Human (GRCh38)
Location 8:143667074-143667096
Sequence GTGTTTGCACAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049632683_1049632691 23 Left 1049632683 8:143667074-143667096 CCTCCCTCCCTCTGTGCAAACAC No data
Right 1049632691 8:143667120-143667142 CCAAATTTCCTCCTCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049632683 Original CRISPR GTGTTTGCACAGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr