ID: 1049633392

View in Genome Browser
Species Human (GRCh38)
Location 8:143672088-143672110
Sequence CCCCGCCCTGCGCAAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049633392_1049633400 -1 Left 1049633392 8:143672088-143672110 CCTGTGCCTTGCGCAGGGCGGGG No data
Right 1049633400 8:143672110-143672132 GGACCTGGTGGGGACCCCAGAGG No data
1049633392_1049633402 5 Left 1049633392 8:143672088-143672110 CCTGTGCCTTGCGCAGGGCGGGG No data
Right 1049633402 8:143672116-143672138 GGTGGGGACCCCAGAGGCAATGG No data
1049633392_1049633407 23 Left 1049633392 8:143672088-143672110 CCTGTGCCTTGCGCAGGGCGGGG No data
Right 1049633407 8:143672134-143672156 AATGGTGTCAGCCCCGGTTATGG No data
1049633392_1049633408 28 Left 1049633392 8:143672088-143672110 CCTGTGCCTTGCGCAGGGCGGGG No data
Right 1049633408 8:143672139-143672161 TGTCAGCCCCGGTTATGGACTGG No data
1049633392_1049633406 17 Left 1049633392 8:143672088-143672110 CCTGTGCCTTGCGCAGGGCGGGG No data
Right 1049633406 8:143672128-143672150 AGAGGCAATGGTGTCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049633392 Original CRISPR CCCCGCCCTGCGCAAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr