ID: 1049634742

View in Genome Browser
Species Human (GRCh38)
Location 8:143681558-143681580
Sequence TACATCCTAGGTTAGAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049634737_1049634742 13 Left 1049634737 8:143681522-143681544 CCAGGGAGGCTGTCAAGGCTGTC No data
Right 1049634742 8:143681558-143681580 TACATCCTAGGTTAGAGCTCAGG No data
1049634736_1049634742 14 Left 1049634736 8:143681521-143681543 CCCAGGGAGGCTGTCAAGGCTGT No data
Right 1049634742 8:143681558-143681580 TACATCCTAGGTTAGAGCTCAGG No data
1049634734_1049634742 24 Left 1049634734 8:143681511-143681533 CCATGTGGCACCCAGGGAGGCTG No data
Right 1049634742 8:143681558-143681580 TACATCCTAGGTTAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049634742 Original CRISPR TACATCCTAGGTTAGAGCTC AGG Intergenic
No off target data available for this crispr