ID: 1049635241

View in Genome Browser
Species Human (GRCh38)
Location 8:143684643-143684665
Sequence GCGGCTGCTGGGACAGACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049635232_1049635241 1 Left 1049635232 8:143684619-143684641 CCCAGGGCTGTGAGACCCAGCGT 0: 1
1: 0
2: 2
3: 24
4: 151
Right 1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 176
1049635233_1049635241 0 Left 1049635233 8:143684620-143684642 CCAGGGCTGTGAGACCCAGCGTC 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 176
1049635231_1049635241 2 Left 1049635231 8:143684618-143684640 CCCCAGGGCTGTGAGACCCAGCG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 176
1049635230_1049635241 5 Left 1049635230 8:143684615-143684637 CCGCCCCAGGGCTGTGAGACCCA 0: 1
1: 0
2: 3
3: 38
4: 360
Right 1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 176
1049635227_1049635241 21 Left 1049635227 8:143684599-143684621 CCTTCTAATTCTGCGGCCGCCCC 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG 0: 1
1: 0
2: 0
3: 14
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049635241 Original CRISPR GCGGCTGCTGGGACAGACCG GGG Intronic
900101895 1:965515-965537 GCAGCTGCTTGGAGAGACCCAGG - Exonic
900436589 1:2633978-2634000 GGGGCTGCTAGGACAGCCAGCGG - Intergenic
900477147 1:2881410-2881432 GGGGCTGCTGGGACTGAAGGAGG + Intergenic
900627627 1:3616471-3616493 GGGGGTGCTGGCACAGACTGGGG - Intergenic
900774723 1:4573941-4573963 GCAGCTCCTGGGGCAGACAGTGG - Intergenic
900986068 1:6073338-6073360 GCTCCTGCTGGGACAGAGCGGGG - Intronic
901646173 1:10717952-10717974 GCGGGTGCAGGGACGGGCCGAGG + Intronic
903085115 1:20849895-20849917 GCAGCTGCTTGAACAAACCGTGG + Intronic
903426256 1:23256612-23256634 GCTGCTGCTAGCACAGAGCGGGG + Intergenic
906541800 1:46592577-46592599 GAGGCTGCTGGAACAGCCCGGGG + Intronic
911348275 1:96722178-96722200 GAGGGGGCAGGGACAGACCGGGG - Intronic
912520408 1:110240921-110240943 GCGGGTCCTGGGGCAGACAGCGG - Intronic
915140442 1:153764629-153764651 GGGGCTGCTGGCACATACGGAGG - Intronic
916412543 1:164559879-164559901 GCAAGTGCTGGGACAGGCCGGGG - Exonic
917968311 1:180192259-180192281 GAGGCTGCAGAGACAGGCCGGGG + Intronic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
920227874 1:204451070-204451092 GAGGCAGCTGGGACAGAGCAGGG - Intronic
1062761795 10:28148-28170 ACAGCTGCTGTGACTGACCGTGG + Intergenic
1064018930 10:11793971-11793993 GAGGCTGCAGGGACAGGCCGGGG + Intergenic
1065366747 10:24944403-24944425 GTGGCTCCTGGGACAGTCCTGGG - Intronic
1066503562 10:36019038-36019060 ACGATTGCTGGGACAGACAGTGG - Intergenic
1067694422 10:48524443-48524465 GCGGCTCCTGGGAGAGCGCGCGG - Intronic
1067769874 10:49115461-49115483 GCGGCTGCTGGCACTGGCGGCGG - Exonic
1068096630 10:52499457-52499479 GCGGCTGCTGGGAGGGATGGGGG + Intergenic
1068637390 10:59362662-59362684 GAGGCTGCGGGGACAGAGCTGGG + Intronic
1069888523 10:71638768-71638790 GGGTCTGCTGGGACAGACTCAGG + Intronic
1072043581 10:91633053-91633075 GCGGTCGCTGGGAGAGACTGAGG + Exonic
1073490906 10:103852714-103852736 GGGCCTGGTGGGACAGACAGGGG - Intronic
1076401822 10:130189930-130189952 GGGGCTGCAGGGACACCCCGGGG + Intergenic
1077483241 11:2826392-2826414 GCGGCTGCTGGGCCTGGCCGCGG - Intronic
1077915206 11:6607123-6607145 GAGGCTGCTGGCCCAGACCACGG + Intronic
1079580353 11:22055919-22055941 ACAGCTGCTGTGACAGATCGTGG - Intergenic
1080345825 11:31323219-31323241 GCGGCTACTTTGACAGACCCTGG + Intronic
1081492587 11:43579633-43579655 GCGGCGGCGGGCGCAGACCGCGG + Intronic
1081873314 11:46392736-46392758 GAGGCTGCTGGGCCAGGGCGCGG - Intergenic
1083276398 11:61599467-61599489 GCCGCAGCAGGGACAGAGCGCGG - Intergenic
1083627487 11:64079045-64079067 GCCGCTGTGCGGACAGACCGGGG + Intronic
1083721436 11:64605592-64605614 GCAGCTGCTGGGACTGAAGGTGG - Intergenic
1083763545 11:64831655-64831677 GCTGCTGCTGGCAGAGAGCGAGG - Exonic
1084137260 11:67194296-67194318 GCAGCTGCTGGGACAGCTGGGGG - Intronic
1085084179 11:73655816-73655838 GCGGCTCCTGGGAGGGACGGTGG - Exonic
1091225349 11:133953785-133953807 ACGGCTGCTGAGCCAGCCCGGGG - Intronic
1091701530 12:2666624-2666646 TGGGCTGCTGGCAGAGACCGTGG + Intronic
1097182374 12:57178781-57178803 GCGGCTGCTGGAACAGGGGGAGG + Intronic
1100408158 12:94288789-94288811 GTGGCTGCTGGGACAGCATGTGG + Intronic
1104945783 12:132414360-132414382 GCGGCAGCTGGGACAGGGTGTGG - Intergenic
1108221071 13:48233503-48233525 GCGGGTGCTGGGCCCGGCCGGGG + Intronic
1111685413 13:91495508-91495530 ACTGCTGCTGGGACAGAGTGAGG - Intronic
1113909534 13:113835698-113835720 GCGGCTGCAGGGACTGGCCAGGG + Intronic
1119898812 14:78243070-78243092 GTCGCTGCTGGGACAGAGCCCGG - Intronic
1123057319 14:105577518-105577540 GCGGGTGCTGGGCCAGAGCCGGG - Intergenic
1123085017 14:105713306-105713328 GCGGCCCATGGGGCAGACCGAGG - Intergenic
1124590279 15:31047559-31047581 GAGGCTGCATGGACAGACAGCGG + Intronic
1125485606 15:40108814-40108836 GCGGCGGCGGGCACAGGCCGGGG + Exonic
1127531081 15:59844062-59844084 GAGGCTGCTGGGAGAAACAGTGG + Intergenic
1131538112 15:93254173-93254195 GCTACAGCTGGAACAGACCGGGG + Intergenic
1132055240 15:98647471-98647493 GCGGCTGCGGGGAGCGGCCGGGG - Intergenic
1133076328 16:3283627-3283649 GCGGCGCCTGGGACCGACTGAGG + Exonic
1135323917 16:21513912-21513934 GAGCCTGCTGGGACAGTCCCAGG - Intergenic
1135598747 16:23763611-23763633 GTGGCTGCTGGGAAAGGCCTTGG + Intergenic
1136335402 16:29607180-29607202 GAGCCTGCTGGGACAGTCCCAGG - Intergenic
1136535029 16:30894129-30894151 GCCGCTCCGGGGACAGGCCGGGG - Exonic
1141727643 16:85800056-85800078 GAGGCTGCAGGCACAGAGCGCGG - Intronic
1142036128 16:87863021-87863043 GGGGCTGCTGAGACAGTCCCAGG - Intronic
1142468104 17:147367-147389 GTGGCTGCTGGGGAAGCCCGGGG + Exonic
1143670602 17:8393267-8393289 GCGGCAGATGGGGCAGACCAGGG + Exonic
1144480145 17:15622238-15622260 GCCGCTGCTGGGCCAGATAGAGG + Intronic
1144918160 17:18741500-18741522 GCCGCTGCTGGGCCAGATAGAGG - Intergenic
1145235488 17:21205170-21205192 GTGGCTGCTGGGACAGGCACAGG - Intronic
1145884270 17:28371725-28371747 GCGGCGGCTGGAACAAAGCGTGG - Exonic
1146646787 17:34581489-34581511 CCGGCTGCAGGGAGAGACGGGGG - Intronic
1146918701 17:36695306-36695328 GAGGCTGCTGTCACAGACTGGGG + Intergenic
1146968946 17:37056705-37056727 GCGGCTGCTGGTCCAGATGGAGG + Exonic
1147179508 17:38675110-38675132 GCGGCGGCTGGGAGGGAGCGCGG + Exonic
1148155871 17:45425122-45425144 GGGGCTCCTGGGACAGCCTGGGG + Intronic
1148912621 17:50950975-50950997 GATGCTGCTGGGTCAGACCTGGG + Intergenic
1151653785 17:75486053-75486075 GCGGCACCTGGGACAGACCAGGG + Intronic
1152223483 17:79081961-79081983 GCGGATGCTGGGGCAGGCTGGGG + Exonic
1152254669 17:79230827-79230849 CCGGCTGCTGGAACAAACCCAGG - Intronic
1152654276 17:81512788-81512810 GCGGCGACTGAGACCGACCGCGG + Intronic
1152841992 17:82575863-82575885 GAGCCTGCTGGGACAGAGGGTGG + Intronic
1152897485 17:82921067-82921089 GAGGCTGCTGAGACAGCCCCGGG - Intronic
1152954702 18:28478-28500 ACAGCTGCTGTGACTGACCGTGG + Intergenic
1156484386 18:37455773-37455795 CCCGCAGCTGGGACAGGCCGAGG + Intronic
1159467483 18:68803602-68803624 GCAGCTGCTGGGAATGAGCGAGG + Intronic
1160462102 18:79047120-79047142 GCGGCTGCTGCGAAAGAGCAAGG - Intergenic
1161321558 19:3643922-3643944 GGGGCTGCTGGGACCGCCCCAGG - Intronic
1162387001 19:10365666-10365688 GAGGCTGCTGGCCCAGGCCGAGG - Exonic
1163476123 19:17527119-17527141 GAGGCTGCGGGGACAGCCCCGGG - Intronic
1163528655 19:17836707-17836729 GAGGCTGCTGGGCCAGCCTGGGG - Intronic
1163766207 19:19164868-19164890 GTGGCTGCAGGGACAGCCCAAGG + Intronic
1163828831 19:19538257-19538279 GCGGCCGCTGGGACTGAGAGTGG - Exonic
1164639304 19:29812487-29812509 GCGGCGGCGGGGTCAGGCCGCGG - Intronic
1165322408 19:35094170-35094192 GCTGCAGCTGTGACAGAACGGGG + Intergenic
1166949387 19:46416503-46416525 GCGGCGGCTGGGACTGAGCCAGG - Intergenic
1166971672 19:46572876-46572898 GAGTCTGCTGGGAGAGACAGAGG + Intronic
925384570 2:3453235-3453257 GCGCCTGCTGGGAAGTACCGGGG - Intronic
926108319 2:10166293-10166315 CCGGCTGCAGGGGCAGGCCGGGG + Intronic
926679402 2:15652469-15652491 GGGGCTGCAGGGAGAGACCATGG - Intergenic
927087985 2:19689926-19689948 GCCTCAGCTGGGACAGACTGGGG - Intergenic
927472280 2:23385412-23385434 GCGGCTGCGGGGAGAGGGCGGGG + Exonic
927558225 2:24050362-24050384 GCGGCTGTGGGGACAGACCCAGG + Intronic
929914871 2:46126510-46126532 GCGGATGCTGTTACAGACAGAGG + Intronic
932445689 2:71779674-71779696 GCGCTTGCAGGGACAGACTGAGG - Intergenic
934993376 2:98936487-98936509 GCCGCTGCGCGGACAGGCCGAGG - Intergenic
936489473 2:112957861-112957883 GCGGGTGCTGGCACAGAGCAGGG - Intergenic
937221300 2:120344544-120344566 GCGGCAGCTGGGACAGAGGCAGG + Intergenic
937572476 2:123380987-123381009 GCGGCTGCTGTGAGAGATAGGGG - Intergenic
941206058 2:162574770-162574792 GGGCCTGCTGGGACTGACTGTGG - Intronic
942292386 2:174486250-174486272 TCGTCTGCAGGGACAGACTGTGG + Intronic
946104692 2:217358833-217358855 GCGGCAACTGGGACAGAACAAGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1170783682 20:19449309-19449331 GCTGCTGCTGGCACTGACAGTGG + Intronic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1171420843 20:25016564-25016586 GCCACTGCTGGGACAGGCTGTGG - Intronic
1173283063 20:41646423-41646445 GCCCCTGCTGGCACAGACCCTGG - Intergenic
1173800486 20:45891682-45891704 ACGGCTGCTTGGCCAGCCCGGGG - Exonic
1175242709 20:57561573-57561595 GCGGCTTCTGGGCCAGATGGAGG + Exonic
1175366806 20:58461432-58461454 GCGGCTGGTGGGTCAGCTCGGGG - Exonic
1175964929 20:62655682-62655704 GCCGCTGCTGGGTCAGCCTGTGG - Intronic
1176008127 20:62877189-62877211 GCGGCTGCAGGGACAGGCTCGGG - Intergenic
1176132042 20:63500291-63500313 GCAGCTGCTGGGCCCGACCCGGG - Intergenic
1179827278 21:43973273-43973295 GAGGCTGCGGTGACTGACCGGGG + Intronic
1180056833 21:45363335-45363357 GCAGAGGCAGGGACAGACCGAGG + Intergenic
1180058071 21:45369311-45369333 GCAGAGGCAGGGACAGACCGAGG - Intergenic
1180593956 22:16961812-16961834 GGGGCTCCTGGGACAGGCAGGGG - Intergenic
1181104628 22:20566625-20566647 GCAGCTGCTGGGGCAGAGCCTGG - Exonic
1181542320 22:23580091-23580113 GCTGCTGCTGGGTCTGGCCGTGG - Exonic
1182050843 22:27311449-27311471 GCGGCTGCCGGGACAGATGAGGG - Intergenic
1182442787 22:30373907-30373929 GCAGCTCCTGGGACAGACGGAGG - Exonic
1183697739 22:39432734-39432756 GCAGGTGCTGGGAGAGACCTGGG - Intronic
1183933604 22:41249579-41249601 AAGGCTGCTGGGGCAGACCCAGG + Intronic
1184640362 22:45867150-45867172 GGGGCTGCTGTGACAGTCCAAGG + Intergenic
1185138880 22:49089320-49089342 GCCTCTGCTGGGGCAGACCCTGG - Intergenic
950129698 3:10533741-10533763 GCCAGTGCTGGGACAGACCCTGG + Intronic
950491151 3:13305803-13305825 TCGGCTGATGGGACAGGCTGGGG + Intergenic
953019991 3:39107253-39107275 GCGGGCGCTGGGCCCGACCGCGG + Intronic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
961330189 3:126133870-126133892 GGAGCTCCTGGGAAAGACCGTGG - Intronic
961646046 3:128393298-128393320 GCTGCTACAGGGACAGACCTGGG + Intronic
962319219 3:134377034-134377056 GCAGCTGCAGGGCCAGACTGAGG - Intergenic
964194891 3:154052012-154052034 GAGGCTGCTGGGACAGAAGTTGG + Intergenic
966888483 3:184389592-184389614 GAGGCAGCTGGGCCAGACCGAGG + Exonic
968501743 4:953355-953377 GTGAGTGCTGGGACAGCCCGTGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
976236258 4:82900596-82900618 TTGGCTGCTGGGACACAACGTGG + Intronic
985489729 5:172217-172239 GAGGATGCTGGGACAGCCTGAGG - Intronic
986723278 5:10575829-10575851 GAGGCTGCTGGGGCCGAGCGTGG + Intronic
988993455 5:36693027-36693049 GGGGCCGCTGGGAGAGCCCGCGG - Intergenic
999152239 5:149433906-149433928 GGGAGTGCAGGGACAGACCGGGG + Intergenic
1002633672 5:180596717-180596739 GTGCCTGCTGGGACTGGCCGAGG - Intergenic
1002941303 6:1718576-1718598 GAAGCTGCCGGGACAGCCCGGGG - Intronic
1003105210 6:3210249-3210271 CCTGCTGCTGGGGCAGACAGAGG + Intergenic
1003119439 6:3307670-3307692 GCACCTGCTGGGACAGCCCCCGG + Intronic
1003645296 6:7909860-7909882 GGGTCGGCTGGGACAGACTGCGG - Intronic
1006445277 6:34076529-34076551 GGGGCTGCTGGCCCACACCGGGG + Intronic
1007371509 6:41429238-41429260 GCGGCTGCAGGGACAGGAAGTGG - Intergenic
1013130327 6:107226601-107226623 GAGGCTGGAGGGACAGACTGAGG + Intronic
1019381632 7:727158-727180 GCAGCTGCTGGGCCTGGCCGTGG + Exonic
1020072654 7:5237659-5237681 GCGTCTGCTCAGACAGACGGTGG - Intergenic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1025022758 7:55492653-55492675 GCGGCCTCTGGGACAGCCCCTGG + Intronic
1026827933 7:73595744-73595766 GCTGCTGCTGGCACAGGCTGGGG + Exonic
1029640319 7:101816165-101816187 CCGGCGGCTGGGCCAGCCCGGGG - Intronic
1030819850 7:114083207-114083229 GCTGCTGCTGGAACTGGCCGGGG - Intergenic
1033539862 7:142346516-142346538 TTGGTTGCTGGGACAGACAGAGG - Intergenic
1034258272 7:149736368-149736390 TTGCCTGCTGGGACAGACCAGGG + Intergenic
1036662302 8:10716174-10716196 GTGGCTGCTGGGACAGGGCGGGG + Intergenic
1046438009 8:114219342-114219364 GCAGCTGCAGGGACAGTCCATGG - Intergenic
1048072858 8:131040210-131040232 GCGGCTGCTGTGGCAGACGGCGG - Exonic
1049580566 8:143408759-143408781 GTGGCTGCTTGGAGAGGCCGGGG + Intergenic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1049777615 8:144413806-144413828 CCAGCTGCAGGGACACACCGTGG + Exonic
1052781206 9:32783373-32783395 GGGGCTGCTGGGAGCGGCCGGGG - Intergenic
1056885874 9:90443271-90443293 GCGTCTCCTGGGAGAGACCCTGG - Intergenic
1057308073 9:93924116-93924138 GGGCCTGCTGGGACAGACCTGGG - Intergenic
1057442375 9:95091578-95091600 GCGGGTGCTGGGAACGACCCTGG - Intergenic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1059753450 9:117271046-117271068 GCGGCTACTAGCACAGACCTGGG + Intronic
1060608647 9:124940895-124940917 GCCGCTGTGGGGACAGACCGAGG + Intronic
1060779256 9:126399611-126399633 GCTGCTGCTGGGACAGAGGTTGG + Intronic
1060790120 9:126480305-126480327 GCGGCTGCTGGGACAGTGGTAGG - Intronic
1061442585 9:130616364-130616386 ACGGCTCCTGGGACAGATTGTGG + Exonic
1061579926 9:131530600-131530622 GGAGTTGCTGGGACAGAACGAGG - Exonic
1061890461 9:133616615-133616637 GCTGCTGCTGGGACAGGCACAGG - Intergenic
1062562580 9:137148285-137148307 TCGGCGGCTGGGCCAGACAGTGG - Intronic
1185726714 X:2427457-2427479 GCAGCTGCAGGGACTGACGGGGG + Intronic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1197893690 X:131289070-131289092 GCGGGTGGGGGGACAGACTGGGG + Intronic
1200746807 Y:6910653-6910675 GCGGCTGCAGCGACAGAGGGCGG - Intergenic
1201304159 Y:12536601-12536623 GCGGGCGCTGGGACAGACGCTGG - Intergenic