ID: 1049636874

View in Genome Browser
Species Human (GRCh38)
Location 8:143693812-143693834
Sequence TTCCCAGAGCTGCTCCAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049636874 Original CRISPR TTCCCAGAGCTGCTCCAGAA AGG Exonic
901964274 1:12853244-12853266 TCTCCAGAGGTGCACCAGAAAGG + Intronic
901970610 1:12904776-12904798 TCTCCAGAGATGCCCCAGAAAGG + Intronic
901977739 1:13008836-13008858 TTACCCGGGCTGGTCCAGAACGG + Intronic
901984604 1:13064485-13064507 TCTCCAGAGATGCTCCAGAAAGG - Intronic
901997206 1:13162285-13162307 TCTCCAGAGATGCTCCAGAAAGG + Intergenic
902004346 1:13220099-13220121 TTACCCGGGCTGGTCCAGAACGG - Intergenic
902014555 1:13296994-13297016 TCTCCAGAGATGCCCCAGAAAGG - Intergenic
902023566 1:13365837-13365859 TTACCCGGGCTGGTCCAGAATGG - Intergenic
902089337 1:13890993-13891015 TTCCAAGTACTACTCCAGAATGG - Intergenic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
902599852 1:17533542-17533564 TTCCCTGAGCTGCTCCTTTACGG - Intergenic
904003978 1:27353779-27353801 TTCGCACGGCTGCTCCAGGAGGG - Exonic
904607174 1:31704269-31704291 TGCCCAGAGCTGCCCTGGAAGGG + Exonic
904850396 1:33454948-33454970 TTCACACAGCTGCTCCTGCAAGG - Intergenic
907842378 1:58170327-58170349 CTCCCATAGCTGCTCGAGGAAGG - Intronic
908252246 1:62274412-62274434 ATTCCAGAGCTGGTCCAGGAGGG - Exonic
908321942 1:62987039-62987061 TTCTCAGTACTGCTCCAGACAGG + Intergenic
908513554 1:64869902-64869924 TCCCTAGAGCTACACCAGAATGG - Intronic
909602147 1:77472206-77472228 ATCCCAGAGTTGGTCCAGCAGGG + Intronic
913087695 1:115454261-115454283 TTCCCAGATCCCCTCCATAAAGG + Intergenic
913382656 1:118228224-118228246 CTCCCATAGCTGCTCAAGGAAGG - Intergenic
915334757 1:155134634-155134656 TCCCCAGAGCTGTGCCAGCAGGG + Exonic
915513715 1:156400888-156400910 TCCCCACAGCTTCTCCACAAAGG + Intergenic
916083706 1:161253102-161253124 CTCCCATAGCTGCTCAAGGAAGG - Intergenic
916604850 1:166330964-166330986 ATCCCAAAGCAGGTCCAGAAAGG + Intergenic
919323138 1:196068881-196068903 TTCCCAGCTCTGCTCCTGTATGG - Intergenic
920379806 1:205528928-205528950 TTCCTAGGGCTGCTCCACCAGGG - Intronic
920591082 1:207219542-207219564 TTTGCAGAGCTGCTTTAGAAAGG + Intergenic
920820635 1:209377395-209377417 TTCCCAGAGATGCTCTAAACTGG - Intergenic
921954741 1:220970438-220970460 TTCCAAGAACTGCTTCAGGAAGG - Intergenic
922330888 1:224574606-224574628 CTCCCTGAGCTTCTCCCGAATGG - Intronic
922493298 1:226036082-226036104 CACCCAGTGATGCTCCAGAAAGG - Intergenic
923288094 1:232516583-232516605 CTCTCAGAGCTGTTCCATAATGG - Intronic
924592571 1:245417720-245417742 TTCCCACATCTGGTCCAGAAGGG - Intronic
1062973412 10:1665643-1665665 TTCCCTGAGCTGCCTCAGAATGG - Intronic
1064187908 10:13179280-13179302 TTCCCAGATATGCTCCAGAATGG + Intronic
1064283591 10:13972344-13972366 TCTCCAGTGCTGCTACAGAATGG - Intronic
1068240687 10:54298156-54298178 CTCCCATAGCTGCTCGAGGAAGG - Intronic
1069771497 10:70903405-70903427 TTCCCAGCTCTGCTCCATGAAGG + Intergenic
1070757266 10:79001118-79001140 GCCCCAGAGGTGCTCCAGAGAGG - Intergenic
1071836931 10:89427497-89427519 TTCCAAAACCTGCTCCATAATGG + Intergenic
1072766234 10:98097206-98097228 CTCACAGAGCTCCCCCAGAATGG + Intergenic
1073719326 10:106148763-106148785 TTGCCATACCTGCTCTAGAATGG - Intergenic
1074361492 10:112827146-112827168 GCCCGAGAGCTGCTCCAGAGTGG + Intergenic
1074823705 10:117199914-117199936 TTCCCAGAGAGGTTCCTGAATGG - Intronic
1075168051 10:120087065-120087087 TTCTCAGAGCTGCTTAAGGAGGG - Intergenic
1075910119 10:126117347-126117369 TTTCCAGTGCTGCTGCAAAAAGG + Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077309655 11:1882691-1882713 TGCACAGACCTGCTCCTGAATGG + Intronic
1078976538 11:16484477-16484499 CTCCCTGAGCTTCTCCTGAATGG + Intronic
1080415236 11:32063810-32063832 TTCTCAGAGGCTCTCCAGAAGGG - Intronic
1080649833 11:34213126-34213148 TTCTCAGAGGGGCTCCAGCAGGG + Intronic
1084737922 11:71117844-71117866 TTCTCTGAGCTGCTCCAGCAAGG + Intronic
1087534534 11:99425880-99425902 TTCACAGCGCTGCTCCAGAAAGG + Intronic
1088812919 11:113403572-113403594 CTCCCAGTGCTGATCCAGAATGG - Intergenic
1088835527 11:113575237-113575259 TTCACACAGCTGTTCTAGAAGGG - Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1090051321 11:123382265-123382287 TTCCCAGCGCTGGTCTTGAAAGG - Intergenic
1090249328 11:125240435-125240457 TTCCCAGCTCCTCTCCAGAAAGG - Intronic
1091705855 12:2692473-2692495 TTCCCACAGCTAAACCAGAAAGG - Intronic
1092045075 12:5425931-5425953 TTCCCTGACCTGCTGGAGAAAGG - Intergenic
1092384678 12:8027001-8027023 ATCCCTGAGGTCCTCCAGAAAGG + Intergenic
1092692696 12:11131240-11131262 CTCCCAGAACTTTTCCAGAAGGG - Intronic
1096600994 12:52729343-52729365 TTCCCAAAGTAGCTCCAGGAAGG - Intergenic
1097686753 12:62698302-62698324 TTCCCAGAGCTGTTCTCCAATGG - Intronic
1099178579 12:79452329-79452351 GTCACACAGCTTCTCCAGAATGG + Intergenic
1100390621 12:94143417-94143439 TTCCCAGGGCTTCCCCAGGATGG + Intergenic
1102045847 12:109829744-109829766 TTCCCTGAGCTCCTCCAGCGGGG + Intronic
1102351202 12:112193594-112193616 TTCCCAGAACTGCTCCGCCACGG - Exonic
1104778764 12:131406272-131406294 TTCTCAGAGCTGCTCCTTATTGG - Intergenic
1105399046 13:20071703-20071725 TTCCTAAAGCTGAACCAGAAAGG - Intronic
1106249989 13:27975968-27975990 TGCGCAGAGCTCCTCCCGAAGGG + Intergenic
1106781704 13:33065070-33065092 TTCCAAGATCTGCTCAAAAATGG - Exonic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1107763174 13:43703487-43703509 TTCCCAGAGACGCTTCAGAGAGG - Intronic
1108708341 13:53010248-53010270 TTCTCAGATTAGCTCCAGAAAGG + Intergenic
1108785120 13:53891234-53891256 GTCCCGGAGCTGTTCCAGAATGG - Intergenic
1110201005 13:72851074-72851096 TTACAACAGCTGCTCCAGATGGG - Intronic
1113865520 13:113519927-113519949 TTCCCTGAGCTACTCCAGGTAGG - Intronic
1114250448 14:20955549-20955571 TCCCCAGAGCTGGGACAGAAGGG + Intronic
1114618882 14:24082845-24082867 CTCCCAGCCCAGCTCCAGAATGG - Exonic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1115860946 14:37685767-37685789 TCCCCAAAGCTGCTGCTGAAAGG - Intronic
1117508972 14:56429609-56429631 GTCCCAGAGCTGCGCCAGCCAGG - Intergenic
1118940605 14:70332748-70332770 TTCCCACAGCAGATCCAGAAGGG + Intronic
1119806809 14:77487584-77487606 TCCCAAGAGCAGCTCCAGAGAGG - Intronic
1120212175 14:81644067-81644089 TTCCCTTAGTTCCTCCAGAAAGG + Intergenic
1121144983 14:91575492-91575514 TTCCCAAAGCTGGACCAAAAGGG + Intergenic
1121326291 14:93021738-93021760 TTCTCAAAGGTGCTCCAGAGAGG + Intronic
1121686661 14:95840495-95840517 ATCCTAGTGCTGCCCCAGAAAGG + Intergenic
1122281004 14:100622386-100622408 GTCCCAGAACAGCTCCTGAAAGG + Intergenic
1122809987 14:104283115-104283137 TTCCCAGCTCCTCTCCAGAAAGG + Intergenic
1122939590 14:104975280-104975302 TTCCCTGAGCTGCACCAGGTGGG + Intronic
1123495506 15:20820740-20820762 TTCCCAGAGTTTCCCCAAAAAGG - Intergenic
1123551994 15:21389854-21389876 TTCCCAGAGTTTCCCCAAAAAGG - Intergenic
1125093402 15:35822609-35822631 TTATCAGTGCTGCTCCAGTAGGG - Intergenic
1125490896 15:40147680-40147702 GCCCCAGGGCAGCTCCAGAAGGG + Intergenic
1125739183 15:41949989-41950011 TCCCCAGAGCTGCTCCCAGATGG + Intronic
1126098471 15:45105772-45105794 GTCCCATAGCTGCTGCACAAAGG + Exonic
1126375160 15:47990252-47990274 TTGCTAAAGCTGCTCTAGAAGGG + Intergenic
1130139237 15:81209672-81209694 TACTCCGAGCTTCTCCAGAAAGG - Intronic
1130141460 15:81229676-81229698 TACTCTGAGCTTCTCCAGAAAGG - Intronic
1131866745 15:96719187-96719209 CTCCCATAGCTGATCCCGAAAGG - Intergenic
1132046092 15:98563879-98563901 CTCCCAGAGCTGCCTGAGAATGG + Intergenic
1202960340 15_KI270727v1_random:117071-117093 TTCCCAGAGTTTCCCCAAAAAGG - Intergenic
1133264517 16:4575333-4575355 GTCCCAGAGCTCCTCCCGGAGGG + Exonic
1133515075 16:6501004-6501026 CTCCCAGAGCTACTTCAGCAGGG + Intronic
1135482016 16:22828508-22828530 TTCCCAAAGCTGCTGAAGCATGG + Intronic
1136922896 16:34346299-34346321 TTACCAGGGCTGCCCCAGGAAGG + Intergenic
1136981677 16:35065507-35065529 TTACCAGGGCTGCCCCAGGAAGG - Intergenic
1137359106 16:47797048-47797070 TTCCCAGAGCAGCTATAGAGTGG + Intergenic
1138542660 16:57697931-57697953 CACCCAGAGACGCTCCAGAATGG + Exonic
1139968977 16:70762047-70762069 CTGCCCCAGCTGCTCCAGAAGGG + Intronic
1140281368 16:73557931-73557953 TCCACAGAGAGGCTCCAGAATGG - Intergenic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1142228058 16:88887005-88887027 TTCCCAGAGCTGCCGCGGGAGGG + Intronic
1142545673 17:700889-700911 TTACCAGACCTGCTCCTGGAAGG - Intronic
1143652534 17:8272500-8272522 TTCCCAAAGCTACTTCAGTATGG - Intergenic
1144999243 17:19291912-19291934 TTCCCAGAGCTGGGCAAGCAGGG - Intronic
1145252702 17:21305063-21305085 AACCCAGAGCTGAACCAGAAGGG + Exonic
1145323870 17:21782846-21782868 AACCCAGAGCTGAACCAGAAGGG - Intergenic
1146835207 17:36105081-36105103 CTTCCAGTGCTGCTCCAGGAAGG + Intronic
1147651124 17:42062598-42062620 TTCCGAGAGGTCCTACAGAAGGG + Intronic
1149314238 17:55423251-55423273 TCCCAAGAGCTCCTCCAGATGGG + Intergenic
1149395078 17:56232052-56232074 TCTTCTGAGCTGCTCCAGAAGGG - Intronic
1154452907 18:14493222-14493244 TTCCCAGAGTTTCCCCAAAAAGG - Intergenic
1156113270 18:33754402-33754424 TTTCCAGAGCTGTTCCAAAAAGG + Intergenic
1157331196 18:46705031-46705053 CTCCCAGTGCTGCGCCAGAATGG - Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1158228825 18:55230753-55230775 TACCCAGAGATTCTCCAAAATGG - Intronic
1158787902 18:60739268-60739290 TTGCAACAGCTGCTCCAGATGGG - Intergenic
1159009317 18:63043242-63043264 TTTCCAGAGCTGCAGCTGAAAGG + Intergenic
1160388351 18:78511838-78511860 GTCGCAGTGCTGCTCCAGAGAGG + Intergenic
1160482345 18:79253186-79253208 TCCCCAGAGCATTTCCAGAAAGG - Intronic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1162548986 19:11348022-11348044 TTAGCAGAGCAGCTCCAGTAAGG - Intronic
1162630528 19:11923947-11923969 TGCTCAGAGCAGCTCCAGAAAGG + Intergenic
1162647396 19:12059770-12059792 TGCGCAGAGCAGCTGCAGAACGG + Intergenic
1162904776 19:13817209-13817231 CCTGCAGAGCTGCTCCAGAAGGG + Exonic
1163730908 19:18948708-18948730 TTCCCACAGCTGCTCCCCCAAGG - Intergenic
1164714281 19:30380074-30380096 TGCACAGAGCAGCTCCAGCAGGG + Intronic
1165087491 19:33361252-33361274 CTCCCTGAGCTTCTCCTGAATGG + Intergenic
1165385914 19:35510627-35510649 TTCCCAGAACTGCCCTAGATGGG + Intronic
1165724669 19:38104458-38104480 TTCCCAGAGCTCCGCCAGCGTGG + Intronic
1166512292 19:43417112-43417134 TTCCCACTGCTGCACGAGAACGG + Intronic
1166795733 19:45424361-45424383 TTCCCAGTGCTGACCCAGAATGG + Intronic
1167715121 19:51138111-51138133 ATCCTGGAGCTGCCCCAGAAAGG + Intergenic
1167998210 19:53423874-53423896 TCCACAGAGCTGCTCCAGGGCGG - Intronic
1167998371 19:53425242-53425264 TCCCCAGAGCTGCTGCAGTGCGG - Intronic
1168007692 19:53504468-53504490 TCCACAGAGCTGCTCCAGGGCGG - Intergenic
1168412232 19:56147189-56147211 CACCCAGAGCTCCTCCAGCAGGG - Exonic
925249654 2:2421596-2421618 ATCCCAGGGCAGGTCCAGAAAGG + Intergenic
925673785 2:6339241-6339263 GTCCCACAGGAGCTCCAGAAAGG + Intergenic
926893614 2:17660238-17660260 TTCCCAAGGCTGGGCCAGAAAGG - Intergenic
929000595 2:37344328-37344350 TTCCCACAGCTCCTAAAGAAGGG - Intergenic
931585317 2:63819979-63820001 GTCCCTGAGTTGCTCCAGTAAGG + Intronic
931779424 2:65566625-65566647 TTCCCAGAGCTTCTCCTGGCAGG - Intergenic
932104983 2:68933933-68933955 ATTCCAGAGCTGCTCCAGCTGGG - Intergenic
933452109 2:82467632-82467654 TTCTCCTAGCTCCTCCAGAAGGG + Intergenic
933771777 2:85749208-85749230 TACTCACAGCAGCTCCAGAAAGG - Intergenic
935828556 2:106976005-106976027 TTCCCAGAGCCACACCTGAAAGG + Intergenic
935853511 2:107248985-107249007 ATCCCACAGCAGATCCAGAAAGG - Intergenic
937861178 2:126711655-126711677 TGCCCAGATCTGCTGCAGACAGG + Intergenic
938139635 2:128784981-128785003 TGTCCAGAGCTGCTGCTGAATGG + Intergenic
938246988 2:129785298-129785320 TTCCCAGAGATGCTCTAGGAAGG - Intergenic
940849962 2:158678727-158678749 TTCCCAGAGCTGGGCCAACATGG + Intronic
944331028 2:198466359-198466381 TGCCCAGAGTGGTTCCAGAATGG + Intronic
945017272 2:205532381-205532403 TTCTCAGACTTACTCCAGAAGGG + Intronic
947213396 2:227728227-227728249 TTCCCAGAGTTGGTACATAAGGG + Intergenic
948759692 2:240182992-240183014 TTCCCAGGGCAGCCCCAGATTGG - Intergenic
1169746653 20:8950130-8950152 ATCCCAGAGCTGACCCTGAAGGG - Intronic
1169830084 20:9815443-9815465 TTTGTAGAGCTGCTTCAGAAGGG - Intronic
1170942780 20:20863022-20863044 AGCCCAGAGCTGGTCCAGTAGGG - Intergenic
1171210479 20:23312837-23312859 TTCCCAGGGCTTCACCAGATGGG + Intergenic
1171261534 20:23738592-23738614 CTCCCATAGCTGCTCGAGGAAGG - Intergenic
1172699989 20:36847174-36847196 TTCGCAGAGCTGCTTGAGCAAGG + Intronic
1174522187 20:51140370-51140392 TTCCAAAATCTGCTCTAGAAAGG - Intergenic
1175221917 20:57422150-57422172 TTCCCAGGGCAGCTCCAGGCAGG - Intergenic
1175950772 20:62581968-62581990 TTGCCAGAGCTGCCCCAGGCGGG + Intergenic
1176165750 20:63672689-63672711 TGGCCAGAGCCCCTCCAGAAAGG - Intronic
1176443130 21:6795057-6795079 TTCCCAGAGTTTCCCCAAAAAGG + Intergenic
1176821296 21:13660102-13660124 TTCCCAGAGTTTCCCCAAAAAGG + Intergenic
1177208683 21:18042543-18042565 TTCCCAGATCTGCTTCACACTGG - Intronic
1179622663 21:42627579-42627601 TTCCAAGGGCTGTTCCTGAAAGG + Intergenic
1180069845 21:45430801-45430823 TTCCCAGGGCAGCCCCACAAAGG - Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1181343941 22:22203480-22203502 TGCCCAGAGCGGCGCCAGCAAGG + Intergenic
1182230778 22:28836001-28836023 TTCCTCCAGCTGCTCCAGACGGG + Intergenic
1183729742 22:39611325-39611347 ATCCCAGATCTGATCCATAAAGG - Intronic
1184358181 22:43996391-43996413 GTCCCAGAGCTTCTCCTGTAGGG - Exonic
1184501588 22:44878025-44878047 TTCCAACAGCTCCTCCAGAGGGG + Intergenic
949905121 3:8852643-8852665 CTGGAAGAGCTGCTCCAGAAAGG - Intronic
950318504 3:12027189-12027211 TTCCCAGCTCTTCTCCATAAAGG + Intronic
951998449 3:28757204-28757226 CTCCCGCCGCTGCTCCAGAAGGG - Intergenic
954587010 3:51744997-51745019 CTCCCATAGCCGCTCGAGAAAGG - Intergenic
956527848 3:70184766-70184788 TTCCCAAAGATTCCCCAGAAAGG - Intergenic
960945691 3:122964915-122964937 TTCCCAGAGGGGCTCCACAGTGG + Intronic
961829480 3:129616112-129616134 TTCCCAGAGCTGTCCAGGAAGGG + Intergenic
961864785 3:129945736-129945758 TCCTCAGAGCTGCTCCACTATGG + Intergenic
964972260 3:162577193-162577215 CTCCCATAGCTGCTCGAGGAAGG - Intergenic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968494081 4:905844-905866 TTCCTTCAGCTGCTGCAGAAAGG + Intronic
968569256 4:1331018-1331040 CTCCCAGAGCTGCTGAAGAGAGG - Intronic
968808990 4:2791786-2791808 GTCCCAGAGCTGCCCAATAATGG - Intergenic
970057271 4:11989029-11989051 ATCTCAGATCTGATCCAGAAGGG + Intergenic
970465137 4:16315038-16315060 TTTCCAGAGCTGCTCCTGTGAGG + Intergenic
971028343 4:22610187-22610209 TTCTCAGGGTTGCTGCAGAAAGG - Intergenic
977564345 4:98566528-98566550 TTCCCATGGCTGCTCCAGCTGGG - Intronic
977628816 4:99218742-99218764 TTCCCAGAGGTGATACCGAAGGG - Intronic
977834902 4:101635597-101635619 CTCCCATAGCTGCTCGAGGAAGG + Intronic
979952341 4:126908476-126908498 CACCCAGAGCTTCTCCATAATGG - Intergenic
980615994 4:135226506-135226528 TTCCCTGAGCTGCTTCACTAGGG + Intergenic
981027626 4:140092781-140092803 CTCCCAAAACAGCTCCAGAAGGG + Intronic
983261382 4:165460607-165460629 TTCCCTTCACTGCTCCAGAAGGG + Intronic
983286296 4:165743540-165743562 GTCACAGAGGTGCTCTAGAAAGG - Intergenic
985329699 4:188817699-188817721 ATCCCATGGCTTCTCCAGAATGG - Intergenic
985665415 5:1179508-1179530 TTCCCAGGGCTGCTCCTGCAGGG + Intergenic
985962487 5:3312996-3313018 TCCCTAGAGCTGCTCCAGCTGGG - Intergenic
986198917 5:5563009-5563031 TTGCCAGAGCTGTTCTGGAAGGG + Intergenic
987020410 5:13864502-13864524 TTCCCAGTGCCGCTCCATCATGG + Exonic
988480489 5:31626415-31626437 TTCCCAGACCTGCTCTAAATTGG + Intergenic
991554513 5:67880542-67880564 TTCCCAGAGTGGCTACAGAGGGG + Intergenic
991979908 5:72220043-72220065 CTCCCAGTGCAGGTCCAGAAGGG + Intronic
992049378 5:72928987-72929009 CTCCCATAGCTGCTCAAGGAAGG - Intergenic
993131211 5:83900502-83900524 TCTGCAGAGCTGCTCCAGGAGGG - Intergenic
994273138 5:97806093-97806115 TTCCTAGACCTGCTCTTGAAGGG - Intergenic
995794033 5:115923475-115923497 TTCCCAGTGCTTCCCCTGAAGGG + Intergenic
996447846 5:123577326-123577348 TTCCTAGTTCTGCTGCAGAAAGG - Intronic
997072415 5:130636276-130636298 TTCCCATAGCTGCTTGAGGAAGG - Intergenic
998576083 5:143318163-143318185 TTCCCTAAGATCCTCCAGAAAGG - Intronic
999511943 5:152261266-152261288 CTCCCTGAGCTTCTCAAGAAAGG - Intergenic
1000426292 5:161094404-161094426 TTCCTATAGCTGGCCCAGAAGGG - Intergenic
1000636831 5:163654217-163654239 TTCCCAGAGCACCTCTGGAATGG - Intergenic
1001008255 5:168074079-168074101 TTCTCAGAGCTGTTTCAGAATGG - Intronic
1002023039 5:176377404-176377426 TTTCCAGAGATGCCCCATAAAGG + Exonic
1002456911 5:179350510-179350532 TTCCCACTTCTCCTCCAGAAGGG + Intergenic
1002962043 6:1924356-1924378 ATCCCACAGATGCTCCAGAAGGG - Intronic
1004078126 6:12364056-12364078 TTCCCAGACATTCTCCAGCAAGG - Intergenic
1004119968 6:12811712-12811734 AGACCAGAGCTGCTTCAGAAAGG - Intronic
1004812251 6:19273897-19273919 CTCCCATAGCTGCTCGAGGAAGG - Intergenic
1005502285 6:26439455-26439477 CTCCCAGAGATCCTTCAGAATGG - Intergenic
1007115200 6:39338583-39338605 TTCCCAGCTCTGCTACACAACGG + Intronic
1007775471 6:44222341-44222363 CTCCCCAAGCTACTCCAGAATGG - Intronic
1007987697 6:46223749-46223771 CAGCCAGAGCTGCTCCAGGATGG + Intronic
1008009863 6:46454905-46454927 TTAGCAGTGCTGCTCAAGAATGG - Intronic
1008586978 6:52959365-52959387 CTCCCATAGCTGCTCGAGGAAGG + Intergenic
1011626213 6:89285779-89285801 TACCCATAGCTGGTCCAGATGGG - Intronic
1012441543 6:99266132-99266154 CTCCCATAGCTGCTCAAGGAAGG + Intergenic
1012956209 6:105572846-105572868 TTCCAAGAGCTTCCCCAGACTGG - Intergenic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1015026566 6:128540217-128540239 TTTCCAGAGTTTTTCCAGAATGG - Intergenic
1015158069 6:130120309-130120331 ATGCCAGAGATGCTCCAAAATGG - Intronic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1016387150 6:143539627-143539649 TGCCCAGAGCTTCTGGAGAAGGG - Intronic
1018989523 6:168662868-168662890 TGCCCTGAGCAGCTCAAGAATGG + Intronic
1020085988 7:5310717-5310739 TTTCCAAAGCTGCTCTAGAATGG - Intronic
1021289409 7:18824228-18824250 GTCCCAGATCAGCTCCAGCAGGG - Intronic
1022833168 7:34088467-34088489 TTCTCAGTGGAGCTCCAGAAAGG + Intronic
1023109217 7:36793186-36793208 TCCCCAGAGAGCCTCCAGAAAGG + Intergenic
1023921584 7:44634210-44634232 GTCCCAGAGTAGCTCCAGACAGG + Intronic
1023997649 7:45171832-45171854 TTTCCATAGCTGTTGCAGAAGGG - Intronic
1024168970 7:46764652-46764674 CACCCAGAGCTGCTCTAGCAAGG - Intergenic
1024188738 7:46983260-46983282 TTCCTATTGCCGCTCCAGAAAGG - Intergenic
1024512582 7:50215321-50215343 TTCCCTCAGCAGCTCCAGCATGG - Intergenic
1025208321 7:57006434-57006456 TTTCCAAAGCTGCTCTAGAATGG + Intergenic
1025216613 7:57061256-57061278 ACCCCAGAGCTGCTGCACAACGG - Intergenic
1025663628 7:63570444-63570466 TTTCCAAAGCTGCTCTAGAATGG - Intergenic
1026435326 7:70391934-70391956 TTCCCTGACCTGCTCCTGCATGG + Intronic
1026846772 7:73703063-73703085 TGGGCAGAGCTGCTCCGGAAGGG + Intronic
1027220620 7:76211510-76211532 TGGCCAGAGCTGTTCCAGGAAGG + Intronic
1027555924 7:79664792-79664814 TTCCCAAAGCAGCTCAACAATGG - Intergenic
1028682544 7:93553296-93553318 TTTCCAGAGCTGCTCAACAAGGG + Intronic
1029551886 7:101240891-101240913 TCCCCAGAGCTGCTGCCCAAAGG - Exonic
1029616610 7:101663190-101663212 TTCCCTGAGCTTCTCCTGTAGGG - Intergenic
1031165732 7:118224916-118224938 TTCACAGAGCTGCTTCAGTCGGG + Exonic
1031858973 7:126957320-126957342 CTGCCACAGCTGCTCCAGACAGG - Intronic
1032709795 7:134451625-134451647 CTCCCTGAGCTTCTCCTGAATGG + Exonic
1032767849 7:135016727-135016749 TTCCCAGAGGTGAGACAGAATGG + Intronic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1035961580 8:4144145-4144167 TTCCCAAAGCTGTATCAGAAGGG - Intronic
1037094946 8:14974907-14974929 TTCCCACAGTTGGTCCAGATTGG - Intronic
1037829016 8:22177335-22177357 CTCCCAGAGGAGCTCCACAATGG - Intronic
1037925609 8:22841912-22841934 TTTCCAGTGCTGCTGCAGAAAGG + Intronic
1039151235 8:34508189-34508211 TTGCCAGAGATGTTCCAAAATGG + Intergenic
1039374103 8:37015919-37015941 AGCCCAGAGAAGCTCCAGAATGG + Intergenic
1039851995 8:41376794-41376816 TTCGCTGAGCGGCTCCAGGAGGG + Intergenic
1041826696 8:62102713-62102735 TCCACAGGGCTGGTCCAGAAAGG + Intergenic
1041971994 8:63754074-63754096 TGTCCAGAGATGCTCCAGATGGG + Intergenic
1044915107 8:97104854-97104876 TTCCCACACCTGCTTCACAAGGG - Intronic
1044972194 8:97630844-97630866 TTGCCCTAGCTGCTCCAAAAGGG - Intergenic
1047033114 8:120905254-120905276 TTCTCAGAACTTCTCCAAAAAGG - Intergenic
1048257061 8:132913082-132913104 TTCACAGATCTGATCCAGAGTGG + Exonic
1048998088 8:139806536-139806558 GTCCCAGAGCAGCTCCCCAAGGG + Intronic
1049604523 8:143523091-143523113 TGCCCAGAGGTGCCCCAGACTGG + Intronic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1051593334 9:18798575-18798597 TTCAGAGAGCTGCTCTACAAAGG - Intronic
1054710879 9:68509668-68509690 TTCCCAGAGAATCTCCAAAAAGG - Intronic
1054791798 9:69263679-69263701 TTTCAAGAGATCCTCCAGAAGGG - Intergenic
1056076271 9:83044191-83044213 TTCACAGAGCATCTGCAGAAAGG + Intronic
1056079820 9:83080272-83080294 TTCCCAGACCTGTTACATAAAGG + Intergenic
1056781741 9:89555821-89555843 TTCCCAGGGCTACTCCTGCATGG - Intergenic
1058601516 9:106675723-106675745 TTCCCAGAACTTCACCTGAAAGG - Intergenic
1059517425 9:114908784-114908806 TTGCCAGAGCTGGTTCAGAAAGG + Intronic
1061359752 9:130133567-130133589 TGCACAGGGCTGCTCCTGAAGGG - Intronic
1061543077 9:131288778-131288800 TTCCCACAGGTGGTCCAGATGGG + Intergenic
1061683718 9:132258287-132258309 TTCCCAGAGCTGGGCCAACACGG - Intergenic
1062220147 9:135410654-135410676 TTTCCAGAGCTGCTGCAGCGAGG - Intergenic
1203526072 Un_GL000213v1:89474-89496 TTCCCAGAGTTTCCCCAAAAAGG - Intergenic
1188790498 X:34403623-34403645 TACCCAGAAGTTCTCCAGAAAGG + Intergenic
1189409309 X:40755781-40755803 TTCCCACAGCAGATCCTGAAGGG - Intergenic
1189908086 X:45782451-45782473 CTCCCAGAGATGCTCCAGCCAGG + Intergenic
1194100136 X:89693801-89693823 TCCACAGGGCTGGTCCAGAAAGG - Intergenic
1194359629 X:92933687-92933709 TTCCCCAGGCTGGTCCAGAATGG - Intergenic
1194974954 X:100385216-100385238 TTCCCACAGCTTCACCAGATTGG + Intronic
1195994889 X:110721938-110721960 TTCCCCCAGTTGCTTCAGAAGGG + Intronic
1196430118 X:115615601-115615623 CTCCCAGTGCTGCACCAGACAGG - Intronic
1198764161 X:140063866-140063888 CTCCCAGAGCTGATCCAAGAAGG - Intergenic
1199182866 X:144878912-144878934 TGCATAGAGCTGCTGCAGAACGG - Intergenic
1199737393 X:150696620-150696642 CTCACAGAACTGCTCCAGACAGG + Intronic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1201312053 Y:12606039-12606061 CTCCCATAGCTGCTCGAGGAAGG + Intergenic
1201530550 Y:14986139-14986161 TTCCCATAGCAGCTCAAGGAAGG - Intergenic