ID: 1049637591

View in Genome Browser
Species Human (GRCh38)
Location 8:143697400-143697422
Sequence CCCGGGGGGTACCGCGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049637591_1049637599 5 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637599 8:143697428-143697450 GGCTTTCCACCCTGCTTAGCAGG No data
1049637591_1049637604 14 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637604 8:143697437-143697459 CCCTGCTTAGCAGGGCTCCAGGG No data
1049637591_1049637607 21 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637607 8:143697444-143697466 TAGCAGGGCTCCAGGGCTCCGGG No data
1049637591_1049637606 20 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637606 8:143697443-143697465 TTAGCAGGGCTCCAGGGCTCCGG No data
1049637591_1049637608 30 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637608 8:143697453-143697475 TCCAGGGCTCCGGGTAGAGCAGG No data
1049637591_1049637602 13 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637602 8:143697436-143697458 ACCCTGCTTAGCAGGGCTCCAGG No data
1049637591_1049637600 6 Left 1049637591 8:143697400-143697422 CCACAGTCGCGGTACCCCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1049637600 8:143697429-143697451 GCTTTCCACCCTGCTTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049637591 Original CRISPR CCCGGGGGGTACCGCGACTG TGG (reversed) Intronic
900019893 1:181100-181122 CCCGGAGAGTACCGCGAGGGCGG - Intergenic
908293264 1:62688485-62688507 CCCGGCGGGAACCCCGGCTGCGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1071573767 10:86711643-86711665 CCCGGGGGGAGCTGCGGCTGCGG - Intronic
1075871278 10:125774031-125774053 CCCCGGGGCTACCCCGACGGCGG - Exonic
1103119996 12:118372512-118372534 CCCGGGAGGGACCGGGACAGCGG - Intronic
1107534038 13:41311104-41311126 CCCAGGGGGTGCCGAGATTGCGG + Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1116817802 14:49599644-49599666 CCCGGGGGAGACGGCAACTGTGG - Intronic
1120827117 14:88966109-88966131 CCCGGGAGGTGCTGAGACTGGGG + Intergenic
1122892423 14:104738964-104738986 ACCAGGGGGTACCCAGACTGAGG + Intronic
1123129232 14:105972300-105972322 CCCGGGGGGCACCTGGACTCCGG + Intergenic
1126406921 15:48331613-48331635 CCCGGAGAGTACCGCGGCTTCGG - Exonic
1152217462 17:79042183-79042205 ACCGAGGGGCACAGCGACTGTGG - Intronic
1152612008 17:81320219-81320241 CACGGGGGGCACCCAGACTGCGG - Intronic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1156008475 18:32470561-32470583 CCGGGGGGGCGCGGCGACTGGGG + Intergenic
1160857538 19:1224190-1224212 CCCGGGGGGTACAGTGTCTGGGG + Intronic
1163390280 19:17026652-17026674 CCTGGGGGGCGCCGCGCCTGGGG + Exonic
1163429425 19:17258200-17258222 CCAGGGGGGTACCTTGGCTGTGG + Exonic
925097858 2:1221650-1221672 ACCGGGGGGGACCGAGACAGAGG - Intronic
935790276 2:106584427-106584449 GCCGGCGGGAACCGGGACTGAGG + Intergenic
948903825 2:240968553-240968575 CCCTGGGGGCACAGCGAGTGGGG + Intronic
1183830962 22:40418222-40418244 CCAGGGGGGTACTGAGACTTAGG - Intronic
955911587 3:63863993-63864015 CCCGGGGAGTACCGGGAGCGCGG - Intergenic
962816579 3:139006106-139006128 CCCGGCGGGTACCCCGGCCGTGG - Exonic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
985003320 4:185506625-185506647 CTCGGGGGGCACCGAGGCTGTGG + Exonic
988177226 5:27743470-27743492 GCCGGCGGGAACCGCGGCTGCGG + Intergenic
1002645558 5:180651433-180651455 CCCGGGGGGTGCTGAGGCTGCGG - Intergenic
1003095517 6:3140062-3140084 CACGGTGGGAACCGCCACTGTGG + Intronic
1007726849 6:43921793-43921815 CCCGGGGGGTCCCGGGAGTAGGG + Intergenic
1020560569 7:9726209-9726231 CCTGGGGGGCGCCGCGCCTGGGG - Intergenic
1029438047 7:100573555-100573577 CCGTGGGGGGACAGCGACTGGGG - Exonic
1029467688 7:100736608-100736630 CCCGGGGGGTACCCTAACGGAGG + Exonic
1049637591 8:143697400-143697422 CCCGGGGGGTACCGCGACTGTGG - Intronic
1062581090 9:137229540-137229562 CCCGGGGTGTACCGGGAGGGTGG + Exonic