ID: 1049638188

View in Genome Browser
Species Human (GRCh38)
Location 8:143700574-143700596
Sequence TCCCCTCGCCGTGGATCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049638182_1049638188 2 Left 1049638182 8:143700549-143700571 CCTGTCCTGTCCATACACAGCCA 0: 1
1: 0
2: 4
3: 9
4: 220
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data
1049638179_1049638188 25 Left 1049638179 8:143700526-143700548 CCTCTTCCTTGCTCGAGTACTGC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data
1049638181_1049638188 3 Left 1049638181 8:143700548-143700570 CCCTGTCCTGTCCATACACAGCC 0: 1
1: 0
2: 2
3: 21
4: 212
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data
1049638183_1049638188 -3 Left 1049638183 8:143700554-143700576 CCTGTCCATACACAGCCAAATCC 0: 1
1: 0
2: 0
3: 5
4: 146
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data
1049638180_1049638188 19 Left 1049638180 8:143700532-143700554 CCTTGCTCGAGTACTGCCCTGTC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data
1049638184_1049638188 -8 Left 1049638184 8:143700559-143700581 CCATACACAGCCAAATCCCCTCG 0: 1
1: 0
2: 1
3: 6
4: 97
Right 1049638188 8:143700574-143700596 TCCCCTCGCCGTGGATCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049638188 Original CRISPR TCCCCTCGCCGTGGATCCCC GGG Intronic
No off target data available for this crispr