ID: 1049638826

View in Genome Browser
Species Human (GRCh38)
Location 8:143705246-143705268
Sequence CTGGGGCAAGAACTGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049638826 Original CRISPR CTGGGGCAAGAACTGTGTTG GGG (reversed) Intronic
901497631 1:9630983-9631005 CTGGGGCATGAACTCTGTCCCGG - Intergenic
901655084 1:10764734-10764756 CTTGGTCCAGAACTGTTTTGAGG - Intronic
905186980 1:36203866-36203888 CTAGGGCAAGAAGAGTGGTGAGG + Intergenic
905369419 1:37475083-37475105 CTGGGGCTGGAAGTGCGTTGCGG - Intronic
906319474 1:44807405-44807427 GAGGGGAAAGACCTGTGTTGTGG + Intergenic
908104671 1:60829080-60829102 CTGGGTCAAGCACTGTGCTTAGG + Intergenic
914926462 1:151893050-151893072 CTTTGGCAAGAGCTGTTTTGAGG + Intronic
915943949 1:160136401-160136423 CTGGGAAAAGAACCCTGTTGGGG - Intronic
918726946 1:187937608-187937630 CTGGGGCCACACCTGTTTTGTGG - Intergenic
918905381 1:190485553-190485575 ATGAGTCAAGAACTGAGTTGAGG + Intergenic
918953778 1:191177482-191177504 CTGGAGAGACAACTGTGTTGGGG + Intergenic
919534453 1:198769811-198769833 CTGGGGGATGAACTCTGTTAAGG - Intergenic
920758432 1:208758214-208758236 TTGGGGCTAGCAGTGTGTTGTGG - Intergenic
921032293 1:211344444-211344466 CTGGGGCAAGAACAGTGCGTCGG + Intronic
921265054 1:213415353-213415375 CTGGGGCTTCAACTTTGTTGTGG + Intergenic
922663187 1:227447769-227447791 CTGGGGAAAGAGCTGTTTTCTGG + Intergenic
924818811 1:247467712-247467734 CTGGGACAAGAAATATGTAGTGG - Intergenic
1065718423 10:28598687-28598709 TTGAGGAAAGAACAGTGTTGTGG - Intronic
1066093302 10:32047758-32047780 TTGAGGCAAAATCTGTGTTGTGG - Intronic
1066165866 10:32788082-32788104 ATGGGGCAAGCTCAGTGTTGAGG - Intronic
1066201086 10:33143190-33143212 ATGGGTCAAGGACTGGGTTGGGG + Intergenic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1069764868 10:70847968-70847990 CAGCGGCATGAACTGTGCTGGGG + Intronic
1073914746 10:108389283-108389305 CTGTGGCTAGAACTGGTTTGAGG - Intergenic
1074132765 10:110596585-110596607 GTGGGGGAAGAACTGTGTTTTGG + Intronic
1074781907 10:116808278-116808300 CTGGGAGAAGAACTCTGGTGGGG + Intergenic
1076871164 10:133195826-133195848 CTGGGGCCATGACTGTGGTGTGG - Intronic
1077888713 11:6403937-6403959 CAGAAGCAGGAACTGTGTTGTGG - Intronic
1078170502 11:8925713-8925735 CAGGGGCAAAAGCTGTGCTGTGG + Exonic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1084117344 11:67049955-67049977 CTGGGGCAAGTAGTTTCTTGCGG + Exonic
1085309477 11:75507605-75507627 GTGGGGCAACCACTGTGTTGGGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086166999 11:83790747-83790769 CTGGGGCAACAACTAGGTTCTGG + Intronic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1088545017 11:110950411-110950433 GTGGGTCAAGAACAGTGCTGAGG + Intergenic
1089503228 11:118945280-118945302 CTGGGGCACCAACTGTATTAGGG - Intronic
1091083527 11:132695995-132696017 CTGGAGGAAGAACTGACTTGTGG - Intronic
1091211421 11:133864461-133864483 CTGTGGGCAGAACTGTGCTGGGG - Intergenic
1092214557 12:6672141-6672163 CTGGGGCAAGAGCTACGTCGGGG - Intronic
1092793328 12:12088002-12088024 CAGGAGCAAGAACTGTGGTGGGG - Intronic
1097290668 12:57911985-57912007 TTGTGACAAGAACTGTTTTGGGG + Intergenic
1099108567 12:78526760-78526782 CTGGGACAAGAACTGTCTCTGGG + Intergenic
1101247906 12:102902478-102902500 CTGGGGCAACAACAGTATTTGGG + Intronic
1102010890 12:109617756-109617778 CAGGGGCCAGAGCTGTCTTGTGG - Intergenic
1103331006 12:120154006-120154028 CTGAGGCAAACACTGTTTTGGGG + Intronic
1103506514 12:121444910-121444932 CTGGGGGAAGGAGTGTGGTGTGG + Intronic
1103597703 12:122034011-122034033 CAGGGGCGAGAACTGGGGTGGGG - Intronic
1106205433 13:27589198-27589220 CTGGGGAAAGAACTTTATTCCGG - Intronic
1109559468 13:64027961-64027983 ATGGGACAAGAACTGTGAGGAGG + Intergenic
1109652848 13:65352766-65352788 CTGGAGCAAGCCCAGTGTTGGGG - Intergenic
1112199639 13:97262186-97262208 CTGCTGCAAGAACAGTGTGGCGG - Intronic
1114666095 14:24377903-24377925 CTGGGGGAAGGAGTGTGTGGAGG + Exonic
1115811423 14:37112723-37112745 CTAGGACAAGAACAGAGTTGTGG + Intronic
1117980269 14:61336007-61336029 GTGAGGCAGGTACTGTGTTGTGG - Intronic
1118898564 14:69967516-69967538 CTGGAAGAAGAACTGTCTTGGGG - Intronic
1119584586 14:75821327-75821349 CTGGGGAGAGAACTGTGTGGAGG - Intronic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1119642239 14:76324080-76324102 TCTGGGCAAGAGCTGTGTTGAGG + Intronic
1119660406 14:76447391-76447413 CTGGGTCAAGAACTGAGAGGAGG - Intronic
1120455688 14:84727550-84727572 CAGAGGCAAGAACAGAGTTGAGG + Intergenic
1121282087 14:92706287-92706309 CTGGGACAAGAAGAGTGTTCTGG + Intronic
1121333256 14:93061190-93061212 CTGGCCCCAGATCTGTGTTGAGG - Intronic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1126323875 15:47454043-47454065 GTGGTGCAAGACCTGTGGTGTGG + Intronic
1131233249 15:90674662-90674684 CTCTGTCAAGAAGTGTGTTGGGG - Intergenic
1131712584 15:95072375-95072397 GTGGGGCAAATGCTGTGTTGGGG - Intergenic
1132379799 15:101358520-101358542 CAGGGGCAGGAACTGTGTCTTGG + Intronic
1133054816 16:3140625-3140647 CTGGGGCCAGAGCTGAGGTGAGG - Intronic
1133194536 16:4159549-4159571 CTGGGCCAAGGACTGTGTGTAGG + Intergenic
1135522488 16:23188139-23188161 CTAGGGCAAATACTGTGTTTGGG - Intronic
1136508880 16:30723753-30723775 CTGGGGCAGGAAGTGTGGTGGGG - Exonic
1137941805 16:52695267-52695289 GTGGGGCAAGAGCTTTGATGAGG - Intergenic
1139857132 16:69990114-69990136 CCGGGGCCAGATCTGAGTTGGGG + Intergenic
1142225271 16:88874112-88874134 CTGGGGTCAGGACTGTGGTGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143478844 17:7217451-7217473 CTGGGGCATGAGCTGGGGTGGGG + Intronic
1144688567 17:17243484-17243506 CTGAGGTAAGAACTGGCTTGTGG + Intergenic
1144793244 17:17873647-17873669 CTGGGGCTAGGGCTCTGTTGAGG - Intronic
1144813403 17:18016789-18016811 GTGGGGGAAGAATGGTGTTGGGG - Exonic
1147320110 17:39640817-39640839 CTGGGGGGAGAAGTGTGTGGTGG + Intronic
1147793838 17:43028905-43028927 CTGGGGCATGAACTGGGATGGGG + Exonic
1150970100 17:70018142-70018164 CTGGGGCAAGGGCTGTGTGTGGG + Intergenic
1151057363 17:71049025-71049047 CTGGGTCCAGAACTGTCTTATGG - Intergenic
1151754689 17:76067026-76067048 GTTGTTCAAGAACTGTGTTGGGG - Intronic
1153910431 18:9701886-9701908 CTAGGGGAAGAACTGTCTGGAGG + Intergenic
1156752504 18:40475907-40475929 CTGGGGAAACAACTTTATTGTGG + Intergenic
1157136062 18:45056717-45056739 CTGGGGCACTAACTGTTTGGTGG + Intronic
1158623483 18:59051972-59051994 CTGGCACAAGAACAGTGATGGGG - Intergenic
1158923616 18:62225835-62225857 GTGGGCCAAGCACTGTGTTAAGG + Intronic
1159602635 18:70443205-70443227 CAGGGACAGGAACTGTGTTAGGG - Intergenic
1159768960 18:72526449-72526471 CTGGTGGAAGAAATGTGTTAAGG + Intergenic
1161176070 19:2842588-2842610 CTGAGGCAACACCTGAGTTGGGG + Intronic
1164755824 19:30688798-30688820 CTGGGGGAAACTCTGTGTTGGGG + Intronic
1166324890 19:42043192-42043214 CTAGGGCAAGGACTGTTCTGTGG - Intronic
1166791022 19:45398431-45398453 CAGGGGAAGGAACTGAGTTGAGG - Intronic
1167080663 19:47274617-47274639 CTGGGAAGAGAACCGTGTTGTGG + Exonic
1167788054 19:51651950-51651972 ATGGGTGAAGAACTGGGTTGTGG - Intergenic
928266141 2:29813454-29813476 CTAAGGAAATAACTGTGTTGAGG + Intronic
929049235 2:37820973-37820995 CTGGGTCAAGGTCTTTGTTGAGG - Intergenic
930021838 2:47006475-47006497 CAGGGGCAGGAACTGGGTTTCGG + Intronic
933229030 2:79784557-79784579 CTGGGGCAAGAGCAGGTTTGGGG - Intronic
933700937 2:85255155-85255177 CTGGGTCAAGAGGTGTGTCGTGG - Intronic
940216500 2:151308998-151309020 CTTGGGCAATCACTGTGTTTGGG - Intergenic
941018208 2:160380845-160380867 CTGGAGCAACTACTGGGTTGCGG - Intronic
941953053 2:171176454-171176476 CTGGGGAAAGAACAGGTTTGGGG - Intronic
942847883 2:180447694-180447716 CTGGGGCAAGTGTTGTATTGTGG + Intergenic
945165884 2:206944372-206944394 CTGGTGCAAGTAATATGTTGAGG - Intronic
945528575 2:210921530-210921552 CTGTGGCAAGAACTCTTTTTAGG - Intergenic
945813037 2:214571114-214571136 CTGAGGCAAGAAATTTGATGTGG - Intronic
947595450 2:231408859-231408881 CTGTGGGAAGACCTGTGCTGAGG - Intergenic
949025215 2:241764628-241764650 CTGAGGCAGGACCTGAGTTGGGG + Intronic
1169973855 20:11301777-11301799 CTGTGGCACCAATTGTGTTGGGG + Intergenic
1171416140 20:24981942-24981964 ATGGGGCATGGCCTGTGTTGTGG + Intronic
1171933061 20:31245941-31245963 CTGGGGCAAAAGCAGTGTTTGGG - Intergenic
1173734122 20:45347811-45347833 CTGGGGCCAGAACTGAGGTTAGG + Intronic
1175902083 20:62363914-62363936 CTGGGGCAAGGTCTGAGATGGGG - Intronic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1179554019 21:42160878-42160900 CTGGGGCAAGAACTGTTCTCAGG + Intergenic
1180190607 21:46160907-46160929 CTGGGGCAAGGACTTGGTTCTGG - Intergenic
1181307067 22:21922970-21922992 CTGGGGAAAGCACTGTGGGGCGG + Exonic
1181808601 22:25390338-25390360 CGGGGGCAAGAACCGTCCTGGGG + Intronic
1182243673 22:28937399-28937421 CTGGTGCACGTACTGTGTTTGGG + Intronic
1182285703 22:29245576-29245598 CTGGGGGAACAGCTCTGTTGGGG + Intronic
949448028 3:4155939-4155961 CTGGGGTAATTACTGTGTTCAGG - Intronic
950002434 3:9667602-9667624 CTGGGGCAAGAGCTGGTTTGTGG - Intronic
952887775 3:38022086-38022108 CTGGGCTAAGAACAGTGTAGGGG + Intronic
954379789 3:50213356-50213378 CTGAGGCCAGGACTGTGTGGAGG + Intronic
954467654 3:50665898-50665920 CTGGGGTATGAACTGTGAGGAGG - Intergenic
955130471 3:56161143-56161165 CTGGAGCAAGAACTGGGAGGAGG - Intronic
961499662 3:127323371-127323393 CTGGAGCAGGACCTGTCTTGTGG - Intergenic
961532377 3:127547503-127547525 CTGGGGCAAGGACTGGGTCCGGG + Intergenic
962848978 3:139293856-139293878 CTGTGCCAAGAACTGTGCTAGGG - Intronic
967412329 3:189179688-189179710 CTGGGCCAAGTACTGTGCTGGGG - Intronic
968134136 3:196209375-196209397 CTGGTGCAACATCTGTGTGGAGG - Exonic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
969343901 4:6559522-6559544 ATGGGGCAAGAATTGGGTTAAGG - Intronic
969393495 4:6906424-6906446 CTGGGGCAAAATGCGTGTTGGGG + Intergenic
970144936 4:13026012-13026034 CTGGGGCTAGGGCTGGGTTGGGG - Intergenic
970608450 4:17704100-17704122 CTGGGGCATGCACTGTTGTGTGG - Intronic
970856119 4:20651077-20651099 CTGGGGCAAGGTCTGAGTAGGGG + Intergenic
972181289 4:36469657-36469679 CAGGGGTAAGAATTGTGATGTGG + Intergenic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
977762719 4:100758983-100759005 CTGGGGCAAGTTCTGAGTGGGGG + Intronic
978605371 4:110473772-110473794 CTGTGGCTAGAACTGGGCTGTGG + Intronic
980187082 4:129475611-129475633 CTGGGGCAAGGTCTGAGTAGGGG - Intergenic
983912982 4:173260554-173260576 CTGAGGCAAGAGTTGTGGTGGGG + Intronic
984632288 4:182073752-182073774 CTGGGGTAAGGACTGAGATGGGG - Intergenic
984923302 4:184784740-184784762 CTGGGGCATGATCTGTGTGATGG - Intronic
985047569 4:185955854-185955876 CTGGGGGAAGACCTGGGGTGGGG - Intronic
986063349 5:4212410-4212432 CTGGTGCTAGGGCTGTGTTGGGG - Intergenic
986614948 5:9606549-9606571 CTGGGGCAGGAACTCTTTGGTGG - Intergenic
988442080 5:31244666-31244688 CTTGGGAAAGAACTGTCATGGGG + Intronic
988911932 5:35852070-35852092 CTGAGGCAAGTACTGTGTGCAGG + Intergenic
989739545 5:44753990-44754012 CTGGTGTCAGAAGTGTGTTGTGG + Intergenic
990036607 5:51329232-51329254 CTGGGACAAGTACTTTATTGAGG - Intergenic
990751424 5:59020877-59020899 CTGGGGCTAGAACTAGGTTTAGG + Intronic
991411663 5:66352169-66352191 CTGGAGGAAAAACTGTGTTGGGG - Intergenic
992237808 5:74730260-74730282 CTGTGGCACGAACTGAGTTTAGG + Exonic
994194706 5:96909514-96909536 GATGGGCAAGAACTGTGTTAAGG + Intronic
996104726 5:119486411-119486433 CTGGGGGAAGAAATGGGGTGAGG - Intronic
997579860 5:135010525-135010547 CTGGGGCTGGAACTGACTTGTGG - Exonic
999499521 5:152132632-152132654 TTGGGGCCAGAATTGTTTTGGGG - Intergenic
999821464 5:155233118-155233140 CTGGGGCTGGATCTGTGCTGTGG - Intergenic
1001930302 5:175668199-175668221 GTGGGCCAAGCACTGTGGTGTGG + Intronic
1005009666 6:21323642-21323664 TAGGGGCAAGAACTGCTTTGGGG + Intergenic
1005632600 6:27722542-27722564 CTGGGGCAAGAACTGACTTGAGG + Intergenic
1006189434 6:32198617-32198639 CTGGGGCAAGAATGGTCTGGAGG - Intronic
1008438456 6:51504053-51504075 CTGGGGCAACAGCTGTCTTAAGG - Intergenic
1009771338 6:68145955-68145977 CTGGGGCATGAAAGGGGTTGAGG + Intergenic
1013490802 6:110644674-110644696 CGGGGGCAAGAAGTGTGCCGAGG - Intronic
1014322402 6:119946421-119946443 CTGGGGTAAGAATTTTGCTGTGG - Intergenic
1015067747 6:129051870-129051892 CAGGGGCATGAACGGAGTTGTGG + Intronic
1015068028 6:129054483-129054505 CAGGGGCATGAACGGAGTTGTGG + Intronic
1017005391 6:150025199-150025221 CTGGGGCAAGAACAGCCTTGGGG + Intronic
1017984532 6:159432083-159432105 TTGGGGCTAGAACAGTGGTGGGG + Intergenic
1023171566 7:37394632-37394654 CTAGGGCAGGAACAGTGTGGAGG + Intronic
1023514859 7:40991888-40991910 TTGTGGCAAGAACAGTGGTGAGG + Intergenic
1029912681 7:104171628-104171650 CTTGGGAAAGTACTGTTTTGAGG - Intronic
1030129669 7:106188090-106188112 GTGGGGCCAGAACTGTCTTGAGG + Intergenic
1035733100 8:1866241-1866263 CTAGGGCAAGGACCGTATTGCGG + Intronic
1036228528 8:6980738-6980760 CTGGGCCAAGAACTGGTCTGAGG + Intergenic
1036230980 8:6999848-6999870 CTGGGCCAAGAACTGGTCTGAGG + Intronic
1042798699 8:72693266-72693288 CTGGGGTAAGAAAAGTGCTGTGG - Intronic
1043142121 8:76603364-76603386 GTGGGGCAAGTACTGTTGTGAGG - Intergenic
1043375474 8:79644584-79644606 CTGGGGTAAGAATTGTGGAGGGG + Intronic
1044347919 8:91127871-91127893 CTGCAGAAAGCACTGTGTTGAGG - Intronic
1044466193 8:92509264-92509286 CTGGGGCAGAAACTAAGTTGTGG - Intergenic
1047102114 8:121688618-121688640 CTGCAGCCAGAACTGTGGTGTGG + Intergenic
1048262418 8:132956313-132956335 CTGTGCCAAGAATTGTGCTGGGG + Intronic
1048727104 8:137398833-137398855 CTGGAGCAAGAAAAGAGTTGAGG - Intergenic
1049265993 8:141668217-141668239 CTGGGGCGAGGACTCTGTGGGGG - Intergenic
1049298162 8:141854859-141854881 CTGGGGAAAGAACGGTGGGGAGG + Intergenic
1049638826 8:143705246-143705268 CTGGGGCAAGAACTGTGTTGGGG - Intronic
1050725683 9:8645411-8645433 CAGTGTCAAGAACTGTATTGAGG - Intronic
1052850935 9:33378103-33378125 CTGGGGTAGGCACTGGGTTGAGG + Intergenic
1057746910 9:97759814-97759836 CTGGGTCAGGAACAGTGCTGGGG - Intergenic
1058818830 9:108710585-108710607 CTGGGGCAAGGAATGTGGTAGGG - Intergenic
1059767683 9:117399260-117399282 CTTGGGAAATAACTGTTTTGGGG + Intronic
1059998328 9:119935226-119935248 CTGGGGCAGAGACTGTATTGGGG + Intergenic
1060269091 9:122128540-122128562 CTGGGGCTAGAACTGTGAAGAGG - Intergenic
1062238267 9:135522957-135522979 CTCTGGCAGGAAATGTGTTGGGG + Intronic
1185574090 X:1156454-1156476 CTGGGGCAAGAGGAGTGTTTCGG - Intergenic
1185807200 X:3069211-3069233 TTGGGGAAAGAACTGAATTGAGG - Intronic
1187376636 X:18761263-18761285 CTGGGCCAAGCACTGTGCTAAGG - Intronic
1189992638 X:46609238-46609260 CCTGGGCATGAACTGTGATGTGG + Intronic
1190021021 X:46875767-46875789 CTGGGGCAAGAAATGGATTAAGG - Intronic
1191217981 X:57952689-57952711 CTGAGTCTAGAAGTGTGTTGGGG + Intergenic
1192544208 X:71999257-71999279 CTCAGGCAAGGACTGTGTTTTGG + Intergenic
1196415670 X:115468572-115468594 CTGGGGCATGAACTCTTTTGGGG - Intergenic
1199855605 X:151756522-151756544 CTGGAGCAAGAACTGTGAGAAGG - Intergenic
1201272365 Y:12267411-12267433 CTGAGGAAAGAACTGAATTGAGG + Intergenic