ID: 1049642104

View in Genome Browser
Species Human (GRCh38)
Location 8:143720463-143720485
Sequence GCTCCTAGAGGGTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049642096_1049642104 5 Left 1049642096 8:143720435-143720457 CCACACTGAAAGCAGGAGCCCCT 0: 1
1: 0
2: 2
3: 26
4: 218
Right 1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1049642091_1049642104 26 Left 1049642091 8:143720414-143720436 CCCAAACCCAACAACTGTTGGCC 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1049642093_1049642104 20 Left 1049642093 8:143720420-143720442 CCCAACAACTGTTGGCCACACTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1049642092_1049642104 25 Left 1049642092 8:143720415-143720437 CCAAACCCAACAACTGTTGGCCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1049642094_1049642104 19 Left 1049642094 8:143720421-143720443 CCAACAACTGTTGGCCACACTGA 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049642104 Original CRISPR GCTCCTAGAGGGTGGCCCAG AGG Intronic