ID: 1049642523

View in Genome Browser
Species Human (GRCh38)
Location 8:143721977-143721999
Sequence AGATTTGAACTGGACATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049642523_1049642533 22 Left 1049642523 8:143721977-143721999 CCTCCAATGTCCAGTTCAAATCT 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1049642533 8:143722022-143722044 CTCCACTGCACCCCCTCTGATGG 0: 1
1: 0
2: 0
3: 21
4: 236
1049642523_1049642527 -7 Left 1049642523 8:143721977-143721999 CCTCCAATGTCCAGTTCAAATCT 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1049642527 8:143721993-143722015 CAAATCTCTCGAGGACCTCAAGG 0: 1
1: 0
2: 1
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049642523 Original CRISPR AGATTTGAACTGGACATTGG AGG (reversed) Intronic
901557990 1:10046707-10046729 AGATCTGAAGTGGACATTGGAGG + Intronic
903273224 1:22205027-22205049 AGATGTGAGCTGGACAGTGTGGG + Intergenic
903318223 1:22525602-22525624 AGATTTGGAAGGGACATAGGTGG + Intronic
904183176 1:28681410-28681432 AGCTTTGAACTGGACTTTGAAGG + Intronic
908926090 1:69256818-69256840 ACATTGGAACTGGACATAAGTGG + Intergenic
909867910 1:80697373-80697395 AGATTTGAAATGGATTTTGGAGG + Intergenic
910922587 1:92365090-92365112 ACATTTGAACTGGATCTTGAAGG - Intronic
911721604 1:101197140-101197162 GAATTTGAGCTGGACCTTGGAGG - Intergenic
912320362 1:108707126-108707148 AGATTTGAAGTGGCCATTGTAGG - Intergenic
912711727 1:111954710-111954732 CCATTTGCAATGGACATTGGAGG - Intronic
913353785 1:117895253-117895275 AGATTTTAATTGGAAAATGGAGG - Intronic
914323055 1:146584048-146584070 CGATCTGAACTGAAGATTGGAGG + Intergenic
915943216 1:160132096-160132118 ATATTTGAGCTGGGCTTTGGAGG + Intronic
917077328 1:171218839-171218861 ACATTTGACCTAGACATTGTAGG - Intergenic
917505269 1:175621667-175621689 AAATTTGAGCTGGACATTGAAGG - Intronic
919078419 1:192840030-192840052 ATATTTGAATTGTACATAGGTGG - Intergenic
919129968 1:193439268-193439290 AGATTTGGACTGGGCTTTTGTGG + Intergenic
920977486 1:210799816-210799838 AGATTTGAGCTGGACTTTGAAGG - Intronic
923402521 1:233628913-233628935 AGCGTTGAACTGGGGATTGGTGG + Intronic
1063193041 10:3715983-3716005 AGATTGGAAATGGACATGAGTGG + Intergenic
1065832476 10:29627465-29627487 AGATTTTATCTGGAAATTGAAGG - Intronic
1065900024 10:30198043-30198065 TGATTGGAACTGGACACTGTGGG + Intergenic
1066489056 10:35876378-35876400 AGATGTGAGCGGGACCTTGGCGG + Intergenic
1069073356 10:64012986-64013008 ATATTTGAGCTGGACAGTGAAGG - Intergenic
1069113547 10:64475977-64475999 AGATTTGAGCTGGGCATGGCAGG + Intergenic
1069739455 10:70678433-70678455 ACATTTGAACTGGGCCTTGAAGG + Intronic
1070052756 10:72905158-72905180 AGATTTGATCTCGATGTTGGAGG - Intronic
1071217316 10:83423130-83423152 TGACTTGAACTTGACAGTGGTGG - Intergenic
1074112071 10:110429779-110429801 ACATTTGAGCTGGACCCTGGTGG - Intergenic
1075304524 10:121355953-121355975 ACATTTGAGCTGGACATGAGGGG - Intergenic
1075670338 10:124260138-124260160 ACATTTGAATTGGACTTTGGAGG - Intergenic
1075776219 10:124990665-124990687 GGATTTGAACTGGAATTAGGGGG - Intronic
1078725381 11:13925669-13925691 ACATTTGAGCTGGCCCTTGGAGG - Intergenic
1079026787 11:16955286-16955308 ATATTTGAACTGGGCCTTGAAGG - Intronic
1079357239 11:19739934-19739956 AGATCTGAAGAGGACAGTGGAGG + Intronic
1080430426 11:32193490-32193512 ACATTTGAACTTGACCTTGAAGG - Intergenic
1080583054 11:33658956-33658978 AGATTGGAACTGGGGATTTGAGG - Intronic
1083060332 11:59863531-59863553 AGATTTGAACTAGGTATGGGTGG - Intronic
1084946024 11:72638964-72638986 AGGCTTGAACTGGACCTTGAAGG - Intronic
1085131307 11:74041377-74041399 ACATTTGAACTGGTCTTTGGAGG - Intronic
1086848138 11:91777185-91777207 TCATTTGAACTGGACCTTGAAGG - Intergenic
1086988737 11:93279314-93279336 ATATTTGAACTGGACCTTGAAGG + Intergenic
1087160825 11:94946601-94946623 AGATTTAAGCTGGACCATGGAGG + Intergenic
1087668423 11:101077356-101077378 TGTTTTGATCTGGAAATTGGAGG - Intronic
1087694076 11:101355686-101355708 AGATTTGTATTTGACATTGCAGG - Intergenic
1089170541 11:116508444-116508466 GGCTTTCAACTGCACATTGGAGG - Intergenic
1089314936 11:117585198-117585220 TGATTTGAAGTGCACTTTGGGGG - Intronic
1089913672 11:122129712-122129734 AAATTTGTGCTGGACATTGAAGG - Intergenic
1091048381 11:132346247-132346269 TGGTTTGGACTGGACATTTGGGG + Intergenic
1092187834 12:6493954-6493976 AGATTTGAACTCGGTATTTGTGG + Exonic
1093738062 12:22646983-22647005 ACATTTGAACTGAACTTTGAAGG + Intronic
1094140701 12:27179186-27179208 ACATTTGAATTGGATCTTGGAGG + Intergenic
1095722192 12:45412866-45412888 ATATTTGAACTGGATTTTGAAGG + Intronic
1096712240 12:53465818-53465840 AGAGTTGAACTAGAGAATGGGGG - Intronic
1096720901 12:53520959-53520981 ACATTTGAACAGGACATCAGGGG - Intronic
1097340988 12:58437930-58437952 AAATTGGAACTGGAAATTGCAGG - Intergenic
1099201007 12:79676857-79676879 AGATTTGAACTGAATCTTGAAGG - Intronic
1099983833 12:89639817-89639839 AGATTTGTCCTGGACCTTGCTGG + Intronic
1101221811 12:102649424-102649446 AGATTGGAAATTGAAATTGGTGG + Intergenic
1101907237 12:108836615-108836637 AGAATTGAAACGGACATTGATGG + Intronic
1102199998 12:111050609-111050631 AGTGATGAACTGGACATAGGGGG - Intronic
1102728581 12:115088208-115088230 ACATTTGAACTAGGAATTGGAGG + Intergenic
1103909370 12:124343957-124343979 TGATATGAACTGGAGATAGGGGG + Intronic
1107334483 13:39339600-39339622 AAATTTAAAATGGATATTGGAGG - Intergenic
1110695904 13:78488228-78488250 AGATTTTAACTTGACATATGTGG - Intergenic
1111782610 13:92747671-92747693 AGAATTGAACTAGACATTGATGG + Intronic
1112197942 13:97243527-97243549 GGATTTGAACTGGGTCTTGGAGG + Intronic
1114207471 14:20586299-20586321 AGATCTGAACTGGGCTTTGAAGG - Intronic
1114587500 14:23827565-23827587 AGATCTGATGTGGACATAGGAGG - Intergenic
1115524636 14:34267430-34267452 AGATGTGAACCTGAAATTGGTGG - Intronic
1115653577 14:35421538-35421560 AGATTTGAATTGGCTCTTGGGGG + Intergenic
1115727949 14:36237655-36237677 ACATTTGAACTGGGCCTTGAAGG + Intergenic
1115952183 14:38733676-38733698 AGATTTGAAATGGAGAAGGGAGG + Intergenic
1117234017 14:53752555-53752577 GGATTTTAAGTGAACATTGGTGG + Intergenic
1117439765 14:55748714-55748736 AGAGTTGAAAAGGACATTTGAGG - Intergenic
1117623034 14:57607579-57607601 GGCTTTGAACTGGACTTTGAAGG - Intronic
1117850626 14:59965265-59965287 ATATTTGATCTGAAAATTGGAGG - Intronic
1118069985 14:62235652-62235674 GGATTTGAGCTGGGCATTGGAGG - Intergenic
1119628543 14:76205428-76205450 AGAATTGAAGAGGACATTGCTGG + Exonic
1119772108 14:77226552-77226574 AGTTTTGAGCTGGGCATTGGAGG + Intronic
1119870489 14:78012619-78012641 GCATTTGAGATGGACATTGGAGG + Intergenic
1120482815 14:85073472-85073494 AAATTTGAAATATACATTGGGGG - Intergenic
1121527635 14:94630395-94630417 AGATCTGAACTGGACCTTGAAGG - Intergenic
1121685583 14:95832675-95832697 ATATTTGGACTGGAAATTGAAGG - Intergenic
1122028903 14:98898418-98898440 GGACTTGAACTGGGCATTTGGGG - Intergenic
1125314008 15:38411604-38411626 AAATGAGTACTGGACATTGGGGG - Intergenic
1125342114 15:38685456-38685478 AGAATTGAAATGGACAGTGCTGG + Intergenic
1127455783 15:59154961-59154983 AGATCAGAACTAGACATTTGGGG + Intronic
1128709393 15:69860428-69860450 GGATTTGAGCTGGGCCTTGGAGG - Intergenic
1129917955 15:79291151-79291173 ACATTTGAACTGAAGTTTGGGGG + Intergenic
1130771005 15:86923460-86923482 AGATTTGAATTGGTCCTTGAAGG - Intronic
1133947275 16:10359370-10359392 ACATTTTAACTGAACACTGGGGG + Intronic
1135488548 16:22887145-22887167 AGGTTTGAAATGGCCTTTGGGGG - Intronic
1139166585 16:64573172-64573194 AGATTTGAAATGGGGATGGGTGG - Intergenic
1139277273 16:65739807-65739829 AGATTAGAATAGGACCTTGGCGG + Intergenic
1139381983 16:66538330-66538352 ATATTTGAACTGGATTTTGAAGG - Intronic
1140010504 16:71126802-71126824 CGATCTGAACTGAAGATTGGAGG - Intronic
1140376283 16:74447875-74447897 AGATGTCAACTCTACATTGGAGG + Intergenic
1146442487 17:32909413-32909435 AGATTTTAATTGTTCATTGGTGG + Intergenic
1147475992 17:40712013-40712035 AGATTTGAGCTGGGCATAAGAGG + Intergenic
1149378500 17:56069553-56069575 ATTTTTGAACTGGAGTTTGGAGG + Intergenic
1150633322 17:66895772-66895794 AACATTGAACTGGACATTTGAGG - Intergenic
1150925830 17:69530882-69530904 AGGTTTGATCTGGAGCTTGGTGG + Intronic
1150930540 17:69579982-69580004 ACATCTGAACTGGACCTTGAAGG + Intergenic
1151205445 17:72502980-72503002 AGACGTGAACTGGACATTCTAGG + Intergenic
1151854845 17:76713519-76713541 AGATTTGAAGTGGAGTCTGGCGG - Exonic
1152326099 17:79638583-79638605 AGATTTCAACATGAGATTGGAGG - Intergenic
1154068349 18:11130161-11130183 AGAGTTGAACTGGAATGTGGTGG - Intronic
1155831484 18:30520622-30520644 AAATTTGAAATGGATTTTGGAGG + Intergenic
1155852484 18:30790047-30790069 AAATTTGAGCTGGATATTGAAGG + Intergenic
1156288191 18:35720874-35720896 AGTTTTGAACTGTTCATTGATGG - Intergenic
1157266791 18:46231140-46231162 AGATTTTAACTTGACCTTGTTGG - Intronic
1157720854 18:49923177-49923199 AGACTTGAGCTGGACTTTGAAGG - Intronic
1157938895 18:51904197-51904219 AGATTTGAATTGGACATTGAAGG - Intergenic
1157997642 18:52578166-52578188 AGATTAAATCTGGACATGGGTGG - Intronic
1158110929 18:53940916-53940938 AGATTGCAACAGGAAATTGGAGG + Intergenic
926943084 2:18158560-18158582 AAATTTGAACTGGGCCTTGTAGG + Intronic
927305905 2:21572546-21572568 AGATTTGAACTGATCAGAGGAGG + Intergenic
928357784 2:30636113-30636135 GCATTTGAACTAGACATTGAAGG + Intronic
928793010 2:34981195-34981217 AGGTTTGAACTTCACACTGGAGG + Intergenic
928980308 2:37129976-37129998 AAATTTGAATTGGAGAATGGTGG - Intronic
932768830 2:74489266-74489288 GAATTTGAACTGGACCTTGAAGG + Intronic
933749823 2:85596066-85596088 AGATTGGAGCTGGAGAGTGGTGG + Intronic
938553349 2:132400912-132400934 GGATTTGAAATGGACTTTGAAGG + Intergenic
938621256 2:133056200-133056222 AGAGTTGACCTGGACACTAGGGG - Intronic
939367133 2:141248142-141248164 AGATTTGAACTGGATACCAGAGG - Intronic
939521388 2:143235297-143235319 AGATTTGAATTGGGCCTTGTAGG + Intronic
947069877 2:226276822-226276844 AGATTTCAAAAGGACACTGGAGG + Intergenic
1169382878 20:5124010-5124032 AGACTAGGACTGGACAGTGGAGG - Intronic
1170564120 20:17585297-17585319 AGATTTGAAATACACATTGAAGG + Intronic
1172240880 20:33411876-33411898 ACATTTGAGCTGGACTTTGATGG - Intronic
1174210328 20:48873214-48873236 AGGTTTGAAATGTACAGTGGAGG - Intergenic
1175633747 20:60562918-60562940 AGATTTGAAATGGAATTTGGGGG - Intergenic
1179076815 21:38129927-38129949 AAATTTAAACTGGACTTTGAAGG - Intronic
1179833085 21:44010741-44010763 TGTTGTGAACTGCACATTGGAGG + Intergenic
1180901240 22:19374878-19374900 AGATGTGGGCTGGACTTTGGGGG - Intronic
1181458344 22:23071777-23071799 ACATTTGAACTGGAGCTTGAAGG + Intronic
1182418144 22:30234634-30234656 ACATTTGAACAGGACCTTGAAGG + Intergenic
1184342533 22:43893813-43893835 AGGTTTGAGCAGGACCTTGGAGG + Intergenic
949377549 3:3407220-3407242 ATATATGAACTGAACACTGGAGG + Intergenic
951723498 3:25727470-25727492 ACATTTGAGCTGGACACTGGAGG - Intronic
954995299 3:54875752-54875774 ACATCTGAACTGGACAATGCAGG + Intronic
955478282 3:59362269-59362291 AGTTTTGAACTTCATATTGGGGG + Intergenic
957553426 3:81735716-81735738 AGATTTAAAGTGTACATTTGTGG + Intronic
957662637 3:83181290-83181312 AGATTCGAAATGGACATGAGTGG - Intergenic
957684743 3:83487453-83487475 AGATTTTGATTAGACATTGGTGG + Intergenic
957752349 3:84437325-84437347 AAATTTGAACTTGTCATTTGAGG - Intergenic
959794961 3:110415440-110415462 AGATTTGAAATGCACATTTATGG + Intergenic
959893136 3:111579128-111579150 AGATTTGGACTGGAGAGAGGTGG - Exonic
960433711 3:117600386-117600408 AGATTTGAACTGAAACTTGGTGG + Intergenic
961053479 3:123767114-123767136 AGACTTGAAAGGGACACTGGCGG - Intronic
961650390 3:128414103-128414125 AGAGGTGAACTAGACGTTGGCGG - Intergenic
963236380 3:142961507-142961529 ACACTTGAACTGGACATCAGGGG - Exonic
963297574 3:143562790-143562812 AGATTTAAATTGGACATATGAGG + Intronic
965788666 3:172363975-172363997 ACATTTGAGCTTGACTTTGGAGG + Intronic
967002874 3:185353782-185353804 ACATTTGATATGGACCTTGGGGG + Intronic
967319846 3:188184500-188184522 GGATTTGAACTGGGCTTTGAAGG + Intronic
969628237 4:8319342-8319364 ACATTTGAGCTGGGCTTTGGGGG + Intergenic
970036671 4:11743477-11743499 CGATTTGATCAGCACATTGGAGG + Intergenic
970039918 4:11785088-11785110 ATCTTTGAATTGGTCATTGGGGG - Intergenic
970331267 4:14986727-14986749 ACATTTGAGCTGTACATTGAAGG - Intergenic
970485276 4:16518945-16518967 GGATTTGAGCTGGACCTTGGAGG - Intronic
974308361 4:60172091-60172113 AAATTTGAACCTGACATTGGAGG - Intergenic
974696650 4:65384232-65384254 AGATTTGAACTACACCTTGAGGG - Intronic
975734919 4:77371763-77371785 AGCTTGGAAGTGGACATTGAAGG + Intronic
976987408 4:91319042-91319064 AGATTAAAAATGGACACTGGAGG - Exonic
977065749 4:92312703-92312725 GGATTTGAGCTGTACATTTGGGG + Intronic
978815540 4:112900697-112900719 AGAATAGAAATGGAAATTGGGGG - Intronic
978963413 4:114711914-114711936 AGATGTGAACTATACAATGGAGG + Intergenic
980643242 4:135606706-135606728 AAATTTGAATTGGAGACTGGTGG - Intergenic
981393739 4:144221443-144221465 AGCACTGAACTGGAAATTGGAGG + Intergenic
982320001 4:154067675-154067697 AGATTTGAACTGGGCAGAGCTGG + Intergenic
986875046 5:12097143-12097165 ACATTTGAGCAGGACCTTGGAGG + Intergenic
994816481 5:104593293-104593315 AAATTTGAATTGGAGAATGGTGG - Intergenic
997604798 5:135167002-135167024 ACATTTGAGCTGGACTTAGGTGG + Intronic
998228293 5:140343511-140343533 AGCTATAAACAGGACATTGGGGG - Intronic
999681170 5:154061621-154061643 AGATTTGAGCTAGACATGGAAGG + Intronic
1000353945 5:160375205-160375227 AGATTTGGACTAGGCATTGAAGG - Intergenic
1000493528 5:161947183-161947205 AGATTTCAACATGACATTTGGGG + Intergenic
1000712087 5:164592886-164592908 CGATGAGAAGTGGACATTGGTGG + Intergenic
1000896850 5:166865683-166865705 CAATTTGAACTGCACATTTGGGG - Intergenic
1001153266 5:169250893-169250915 AAATTTGAAATGGGCATTGATGG - Intronic
1003879897 6:10470654-10470676 AGATTTGAGCAGCACAGTGGTGG - Intergenic
1005252267 6:23960993-23961015 AGATTTGAGCTAGATATTGTAGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1008862749 6:56169679-56169701 ATTTTTGAACTGGACCTTGAAGG - Intronic
1008905220 6:56669980-56670002 AGATATGAACTGGAAACTTGTGG + Intronic
1012134832 6:95542903-95542925 AGATTTTTACAGTACATTGGAGG + Intergenic
1012433867 6:99193910-99193932 AGATGTGAAGTGCACATTAGAGG - Intergenic
1012534860 6:100283327-100283349 AGATTTGAACTGAATCTTGAAGG + Intergenic
1012596319 6:101045431-101045453 AGATTTCAAATGGACATTTTTGG + Intergenic
1013846979 6:114464737-114464759 GGATTTGAACTGGAAAAAGGAGG + Intergenic
1015231491 6:130920379-130920401 AAACTTGTACTGGACATTGCAGG + Intronic
1017410271 6:154160888-154160910 GGAGTTGAAGTGGGCATTGGAGG - Intronic
1017412354 6:154181813-154181835 GGACTTGAACTGGACACTTGGGG + Intronic
1021246834 7:18273596-18273618 AAATTGGAAATGGAAATTGGAGG + Intronic
1021800306 7:24298895-24298917 TCATTTGAATTGGACCTTGGTGG + Intergenic
1024470282 7:49762712-49762734 AGAATTGAAGTCAACATTGGGGG + Intergenic
1024855212 7:53770799-53770821 AGAATGGCACAGGACATTGGAGG - Intergenic
1025148768 7:56528158-56528180 GGATAAGAACTGAACATTGGTGG - Intergenic
1026497655 7:70917584-70917606 AGGTGTGAACTGGATATTGGAGG - Intergenic
1026504182 7:70968262-70968284 ACATTTGAGCTGGACTTTGGAGG + Intergenic
1027709165 7:81575886-81575908 AAATTTGATCAGGACATTGCAGG + Intergenic
1028952379 7:96651079-96651101 AGCTTTGAACTGCACGTGGGTGG + Intronic
1032006289 7:128304622-128304644 AGATTTCAAGTGGACACTGCTGG + Exonic
1032460086 7:132103712-132103734 AGATTTGAGCTGCATCTTGGAGG - Intergenic
1035379690 7:158429811-158429833 AGATTTGGACTTGACATTTCAGG - Intronic
1037586341 8:20279111-20279133 ACATTTGAGCTGGACCTTGAAGG - Intronic
1038914005 8:31999965-31999987 AGATTTGAAGGGAACACTGGTGG + Intronic
1039738273 8:40355904-40355926 ATATTTGCACTGGGCATTGCTGG + Intergenic
1040031783 8:42831722-42831744 AGAAATCAACTGGAAATTGGAGG - Intergenic
1040825121 8:51612167-51612189 AGTTTTGAAGAGCACATTGGTGG + Intronic
1041629945 8:60075976-60075998 ATGTTAGAAATGGACATTGGAGG + Intergenic
1042126456 8:65542206-65542228 AGAGTTTAACTGGACCTTAGAGG - Intergenic
1042392687 8:68254408-68254430 GAATTGGAAATGGACATTGGAGG + Intergenic
1043132786 8:76482326-76482348 AGATTTGAAATGGAGATTATAGG - Intergenic
1045848642 8:106666723-106666745 AGACTTCACCTGGACAGTGGAGG + Intronic
1046538372 8:115546943-115546965 ACATTTGAACTGGACTTTGTGGG - Intronic
1047339271 8:123964755-123964777 GGATTTGAATTGAGCATTGGTGG - Intronic
1049076031 8:140396732-140396754 AGATTGGAACTGGGCCTTGAAGG - Intronic
1049642523 8:143721977-143721999 AGATTTGAACTGGACATTGGAGG - Intronic
1052233554 9:26183884-26183906 AGATCTGAAAGGGACATTAGAGG - Intergenic
1053409334 9:37905313-37905335 ACGTTTGAACTGGGCCTTGGAGG + Intronic
1053745758 9:41195811-41195833 AAATTTTAAATGGACATTTGTGG + Intronic
1054481512 9:65669405-65669427 AAATTTTAAATGGACATTTGTGG - Intronic
1054682585 9:68235462-68235484 AAATTTTAAATGGACATTTGTGG - Intronic
1056364267 9:85887503-85887525 ATATTTGAACTGGACACTGAAGG - Intergenic
1058740770 9:107939980-107940002 AGATATGAACTGGACTTCGAAGG - Intergenic
1059696712 9:116736771-116736793 AGATTTGAAATGGACACTCTTGG - Intronic
1060569437 9:124624722-124624744 TGATTTGAGCTTGCCATTGGTGG + Intronic
1061175656 9:128994944-128994966 AGATTTTAACTGAAGGTTGGGGG + Intronic
1061210975 9:129193112-129193134 GGATTTGAACTGAAAATTGGGGG + Intergenic
1202781890 9_KI270718v1_random:6590-6612 AAATTTTAAATGGACATTTGTGG + Intergenic
1186932612 X:14411419-14411441 TGATTTGAACTGGGCATTGAAGG + Intergenic
1187457527 X:19455658-19455680 AGATTTGAAATGGAAAATTGGGG - Intronic
1187542218 X:20208174-20208196 TGATGTGAACTGCACATGGGAGG - Intronic
1189195818 X:39151596-39151618 GCATTTGAGCTGGACCTTGGTGG + Intergenic
1189613950 X:42765520-42765542 AAATTTGAATTGGAGAATGGTGG - Intergenic
1190072509 X:47290898-47290920 AAATTTGAATTGGAGAATGGTGG + Intergenic
1190752073 X:53371163-53371185 AGATTTGAAAAGGAGATTGAGGG + Intergenic
1191166303 X:57395442-57395464 AGAACTGAACAGGATATTGGTGG - Intronic
1191896310 X:65997192-65997214 AGATTTGAACTGAAACTTGAAGG - Intergenic
1192186396 X:68949566-68949588 AGATTTGAACTTTACATAGAAGG - Intergenic
1192573500 X:72224833-72224855 AGATTTGAATTAGAGAATGGTGG - Intronic
1192948033 X:75986671-75986693 ATGTCTGAATTGGACATTGGAGG + Intergenic
1193823386 X:86194339-86194361 AAATTTGAACTGGATATTGGGGG + Intronic
1199952533 X:152716983-152717005 AGAACTGAACTGAACCTTGGAGG - Intronic
1199957150 X:152751465-152751487 AGAACTGAACTGAACCTTGGAGG + Intronic
1201465234 Y:14273411-14273433 GCAGTTGACCTGGACATTGGAGG + Intergenic
1202249217 Y:22852642-22852664 AGATTTTCACTGGACATTCTGGG + Intergenic
1202402203 Y:24486390-24486412 AGATTTTCACTGGACATTCTGGG + Intergenic
1202468577 Y:25183694-25183716 AGATTTTCACTGGACATTCTGGG - Intergenic