ID: 1049645290

View in Genome Browser
Species Human (GRCh38)
Location 8:143733365-143733387
Sequence TCCAGCTAGGCCGCGAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049645283_1049645290 -10 Left 1049645283 8:143733352-143733374 CCAGCACCCAGACTCCAGCTAGG 0: 1
1: 1
2: 2
3: 16
4: 226
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645272_1049645290 28 Left 1049645272 8:143733314-143733336 CCCGGGCGGATGTCCCCAGGGAA 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645280_1049645290 1 Left 1049645280 8:143733341-143733363 CCAGGCCGTGCCCAGCACCCAGA 0: 1
1: 0
2: 1
3: 41
4: 413
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645277_1049645290 15 Left 1049645277 8:143733327-143733349 CCCCAGGGAAGGGTCCAGGCCGT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645279_1049645290 13 Left 1049645279 8:143733329-143733351 CCAGGGAAGGGTCCAGGCCGTGC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645282_1049645290 -9 Left 1049645282 8:143733351-143733373 CCCAGCACCCAGACTCCAGCTAG 0: 1
1: 2
2: 0
3: 18
4: 205
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645281_1049645290 -4 Left 1049645281 8:143733346-143733368 CCGTGCCCAGCACCCAGACTCCA 0: 1
1: 0
2: 4
3: 76
4: 632
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645273_1049645290 27 Left 1049645273 8:143733315-143733337 CCGGGCGGATGTCCCCAGGGAAG 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data
1049645278_1049645290 14 Left 1049645278 8:143733328-143733350 CCCAGGGAAGGGTCCAGGCCGTG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1049645290 8:143733365-143733387 TCCAGCTAGGCCGCGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049645290 Original CRISPR TCCAGCTAGGCCGCGAGGGC GGG Intronic
No off target data available for this crispr