ID: 1049649719

View in Genome Browser
Species Human (GRCh38)
Location 8:143760054-143760076
Sequence TCTGGGGCCCCAAAACACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049649719_1049649727 25 Left 1049649719 8:143760054-143760076 CCATGGTGTTTTGGGGCCCCAGA No data
Right 1049649727 8:143760102-143760124 TCTGTGGGCCCTGAAAGCGCAGG No data
1049649719_1049649725 10 Left 1049649719 8:143760054-143760076 CCATGGTGTTTTGGGGCCCCAGA No data
Right 1049649725 8:143760087-143760109 CACCAAAATCAGTGTTCTGTGGG No data
1049649719_1049649724 9 Left 1049649719 8:143760054-143760076 CCATGGTGTTTTGGGGCCCCAGA No data
Right 1049649724 8:143760086-143760108 TCACCAAAATCAGTGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049649719 Original CRISPR TCTGGGGCCCCAAAACACCA TGG (reversed) Intergenic
No off target data available for this crispr