ID: 1049651524

View in Genome Browser
Species Human (GRCh38)
Location 8:143771951-143771973
Sequence GCGGTGCTGAAGGAGGTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049651508_1049651524 26 Left 1049651508 8:143771902-143771924 CCGCCGCCTGCTGGACGCCGCCT No data
Right 1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG No data
1049651509_1049651524 23 Left 1049651509 8:143771905-143771927 CCGCCTGCTGGACGCCGCCTTCG No data
Right 1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG No data
1049651516_1049651524 9 Left 1049651516 8:143771919-143771941 CCGCCTTCGACGGGGACGTGGGC No data
Right 1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG No data
1049651517_1049651524 6 Left 1049651517 8:143771922-143771944 CCTTCGACGGGGACGTGGGCGAG No data
Right 1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG No data
1049651510_1049651524 20 Left 1049651510 8:143771908-143771930 CCTGCTGGACGCCGCCTTCGACG No data
Right 1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049651524 Original CRISPR GCGGTGCTGAAGGAGGTCAG CGG Intergenic
No off target data available for this crispr