ID: 1049651988

View in Genome Browser
Species Human (GRCh38)
Location 8:143773991-143774013
Sequence TTGGCCATCCACAGGCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049651984_1049651988 -7 Left 1049651984 8:143773975-143773997 CCATGGTGCTGGAGCATTGGCCA No data
Right 1049651988 8:143773991-143774013 TTGGCCATCCACAGGCAAAGGGG No data
1049651980_1049651988 14 Left 1049651980 8:143773954-143773976 CCAGGGGACTGTGTGTTCACTCC No data
Right 1049651988 8:143773991-143774013 TTGGCCATCCACAGGCAAAGGGG No data
1049651979_1049651988 23 Left 1049651979 8:143773945-143773967 CCTTGGGTGCCAGGGGACTGTGT No data
Right 1049651988 8:143773991-143774013 TTGGCCATCCACAGGCAAAGGGG No data
1049651978_1049651988 24 Left 1049651978 8:143773944-143773966 CCCTTGGGTGCCAGGGGACTGTG No data
Right 1049651988 8:143773991-143774013 TTGGCCATCCACAGGCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049651988 Original CRISPR TTGGCCATCCACAGGCAAAG GGG Intergenic
No off target data available for this crispr