ID: 1049653096

View in Genome Browser
Species Human (GRCh38)
Location 8:143784831-143784853
Sequence TACTATGTCTAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049653089_1049653096 15 Left 1049653089 8:143784793-143784815 CCACCAAAACCACAAATTGGTCA No data
Right 1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG No data
1049653091_1049653096 12 Left 1049653091 8:143784796-143784818 CCAAAACCACAAATTGGTCAGGA No data
Right 1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG No data
1049653092_1049653096 6 Left 1049653092 8:143784802-143784824 CCACAAATTGGTCAGGAAGTGTA No data
Right 1049653096 8:143784831-143784853 TACTATGTCTAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049653096 Original CRISPR TACTATGTCTAGAAGGTGGA AGG Intergenic
No off target data available for this crispr