ID: 1049653504

View in Genome Browser
Species Human (GRCh38)
Location 8:143787748-143787770
Sequence CAGGATGAGGGGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049653504_1049653515 16 Left 1049653504 8:143787748-143787770 CCCACCTCCTTCCCCTCATCCTG No data
Right 1049653515 8:143787787-143787809 GCCACAAACCCCTTGCTCTGTGG No data
1049653504_1049653517 17 Left 1049653504 8:143787748-143787770 CCCACCTCCTTCCCCTCATCCTG No data
Right 1049653517 8:143787788-143787810 CCACAAACCCCTTGCTCTGTGGG No data
1049653504_1049653519 24 Left 1049653504 8:143787748-143787770 CCCACCTCCTTCCCCTCATCCTG No data
Right 1049653519 8:143787795-143787817 CCCCTTGCTCTGTGGGAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049653504 Original CRISPR CAGGATGAGGGGAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr